ID: 1029105461

View in Genome Browser
Species Human (GRCh38)
Location 7:98171647-98171669
Sequence CAGGAAGTGCAGCTTGTGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029105461_1029105466 2 Left 1029105461 7:98171647-98171669 CCATGCACAAGCTGCACTTCCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1029105466 7:98171672-98171694 CAGGTGGGTACCTGCGTCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 110
1029105461_1029105470 28 Left 1029105461 7:98171647-98171669 CCATGCACAAGCTGCACTTCCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1029105470 7:98171698-98171720 ACGCCCCACACAGCACCGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 99
1029105461_1029105468 24 Left 1029105461 7:98171647-98171669 CCATGCACAAGCTGCACTTCCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1029105468 7:98171694-98171716 GTGCACGCCCCACACAGCACCGG 0: 1
1: 0
2: 0
3: 23
4: 123
1029105461_1029105469 27 Left 1029105461 7:98171647-98171669 CCATGCACAAGCTGCACTTCCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG 0: 1
1: 0
2: 6
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029105461 Original CRISPR CAGGAAGTGCAGCTTGTGCA TGG (reversed) Exonic
900392276 1:2438857-2438879 CAGGGGGCGCAGCGTGTGCAGGG + Intronic
900842073 1:5059865-5059887 CAGGCAAAGGAGCTTGTGCAGGG + Intergenic
903594179 1:24481364-24481386 CAGGCAGTGTATCTTGTGCCTGG + Intergenic
904000273 1:27335022-27335044 CAGGAATTGCAGTTTGGGTATGG - Intronic
904038252 1:27570192-27570214 CCGGCAGGGCAGCTTGGGCAGGG - Intronic
905250652 1:36646203-36646225 CAGGAAGGTCAGCATGTGGAGGG - Intergenic
905660047 1:39714906-39714928 AAGGAACTGCAGCTGATGCAAGG - Intronic
907240255 1:53077324-53077346 CTTGAGGTGCAGCTTGTACAGGG - Exonic
907251284 1:53141551-53141573 CAGGAAACGCAGCTTCTTCATGG + Intronic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
908444577 1:64188932-64188954 GAGGAGGTGCAGATAGTGCATGG + Intergenic
908617976 1:65944748-65944770 CAGGAAGTGTAGCTTGGGTCTGG + Intronic
909068558 1:70964498-70964520 CAGGAAAGACAGCATGTGCAGGG + Intronic
909830651 1:80185357-80185379 CAGAAAAGACAGCTTGTGCAGGG - Intergenic
910479015 1:87638342-87638364 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
911404206 1:97415802-97415824 TAGCATGTGCAGCTTGTACAGGG + Intronic
912344120 1:108948277-108948299 CAGGAACTGCAGCTTCTCCAGGG + Intronic
912570264 1:110616239-110616261 CAGGAAGTGAAGCCTGGGCCAGG - Intronic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
916106763 1:161438724-161438746 GAGGAAGGGCAGCTAGTCCAGGG + Intergenic
918877361 1:190065345-190065367 CAGGAATATCAGCTTGTGGAAGG - Intergenic
919853654 1:201691007-201691029 CAGGAAGTGAAGCTTGGGGAGGG + Intronic
921033667 1:211356060-211356082 CAGGAGGTGAAGCTTGGCCAAGG - Intronic
921807383 1:219471796-219471818 CAGGCAAGGCAGCGTGTGCAGGG + Intergenic
922002094 1:221489377-221489399 CAGGATGTGAAGCTGATGCAGGG - Intergenic
922074344 1:222228011-222228033 CAGGAAAAAGAGCTTGTGCAGGG + Intergenic
922235201 1:223717511-223717533 CAGGCAGTCCAGAGTGTGCAGGG + Intronic
924182099 1:241449047-241449069 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
1062846594 10:711928-711950 CAGGCAGTGAAGCCTATGCAGGG - Intergenic
1062895507 10:1100328-1100350 GAGGCAGTGCAGCCTGTGGACGG + Intronic
1063686208 10:8239434-8239456 TAGGAGGTGCAGCTTCAGCAAGG + Intergenic
1063940549 10:11124033-11124055 CAGGCAGGAGAGCTTGTGCAGGG + Intronic
1064907312 10:20360799-20360821 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
1066656894 10:37704949-37704971 CAGGGAGTTCTGCCTGTGCAGGG - Intergenic
1067041420 10:42955187-42955209 CAGGGAGTTCTGCCTGTGCAGGG - Intergenic
1067143093 10:43672532-43672554 CAGGAACTGCAGCTAGTCCTAGG - Intergenic
1067289578 10:44931479-44931501 GAGGAAGTGGAACTGGTGCAGGG + Intronic
1070363959 10:75717674-75717696 CAGCAACTGCAGCTTGTGCAGGG - Intronic
1070398639 10:76033852-76033874 CAGCAAGTCAGGCTTGTGCAGGG - Intronic
1070645161 10:78196644-78196666 GAGGAAGTGCAGGCTTTGCAAGG + Intergenic
1072623841 10:97098501-97098523 CAGGAAGCCCAGCGTGTGCTGGG + Intronic
1073827611 10:107342897-107342919 AAGTAAGTGCAGCTTGGGGAAGG + Intergenic
1074100025 10:110347641-110347663 CAGGAAGTCCGGCTCGTTCAGGG - Intergenic
1074719043 10:116248879-116248901 CAGGAATTGCAGGGTGTGCATGG - Intronic
1074784763 10:116829223-116829245 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1075038759 10:119091031-119091053 CATGAAGTGCAGCTCCTGCTTGG + Intergenic
1075427454 10:122352913-122352935 AATGAGGTGAAGCTTGTGCATGG + Intergenic
1077089248 11:771004-771026 GAGGAAGAGCAGGTTCTGCACGG + Exonic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078476665 11:11636076-11636098 AAGGGAGAGCAGCTTGTGCGGGG - Intergenic
1078573903 11:12482739-12482761 CAGGCAGAAAAGCTTGTGCAGGG + Intronic
1080993889 11:37577529-37577551 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
1081948728 11:47023331-47023353 CAGGAGGTCCAGCTTCTGCAGGG - Intronic
1082638634 11:55627670-55627692 CAGGCAAGGGAGCTTGTGCAGGG - Intergenic
1084542530 11:69796579-69796601 CAGGCAGGGCAGCCTTTGCAGGG - Intergenic
1084801710 11:71548356-71548378 GAGGAAGTGCAGCTTCCTCAAGG - Intronic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1085484666 11:76851839-76851861 CAGGAAGTCTAGCTTGCTCAAGG + Intergenic
1085521369 11:77140684-77140706 CAGGGAGTGCAGCTGGGGCTTGG + Intronic
1086542771 11:87932407-87932429 CATGAAGAGAAGTTTGTGCAGGG + Intergenic
1086542901 11:87933939-87933961 CATGAAGAGAAGTTTGTGCAGGG + Intergenic
1087057991 11:93952221-93952243 CAGGAAGTGAAACTTATCCATGG + Intergenic
1087891887 11:103544954-103544976 CATGAAGTGCAGATAGTGCATGG - Intergenic
1087909550 11:103737403-103737425 CAGGAATAGTAGCTTGTCCAAGG - Intergenic
1089071330 11:115701691-115701713 TAGGAAGTGCAGGCTGGGCAGGG - Intergenic
1089295211 11:117463317-117463339 CAGGTAATGCTGCTTGTCCAGGG - Intronic
1091362442 11:134988213-134988235 CAGGGAGCGCAGCCTGTGAAAGG - Intergenic
1091795254 12:3294345-3294367 TGGGAAGTTCACCTTGTGCACGG - Intergenic
1095188822 12:39232584-39232606 CAGGCAAAGGAGCTTGTGCAGGG + Intergenic
1095566311 12:43628135-43628157 CAGGCAAGGGAGCTTGTGCAGGG + Intergenic
1095951136 12:47782568-47782590 CAGGAAGGGCAGATTGTTAAAGG + Exonic
1096434635 12:51578557-51578579 CAGGAAATGCAGCTTTAACAAGG + Intergenic
1097587328 12:61530389-61530411 CAGGAAAGAGAGCTTGTGCAGGG + Intergenic
1101000995 12:100357116-100357138 CAGAGCGTGCAGCTTTTGCAAGG + Exonic
1102767531 12:115446546-115446568 AAGGAGGTGCAGCTTCTGCCTGG - Intergenic
1102965693 12:117123847-117123869 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1104621284 12:130314694-130314716 CAAAAAGAGGAGCTTGTGCAAGG + Intergenic
1104764148 12:131315622-131315644 CAGGAGGTGATGCTTGTGCCTGG - Intergenic
1105846213 13:24296540-24296562 CTGGAATTGCAACTTGTTCAGGG - Intronic
1107649985 13:42535382-42535404 CAGGCAAGACAGCTTGTGCAGGG + Intergenic
1107679291 13:42831637-42831659 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1108102215 13:46968680-46968702 CATGAAGTGAAGCCTGTGCTGGG - Intergenic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1111036034 13:82676370-82676392 CAGGAAAGGGAGCTTGTGTAGGG + Intergenic
1112397985 13:99050946-99050968 CAGGATGAGCTGCTTGTGCTTGG - Intronic
1112588934 13:100746096-100746118 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1113067290 13:106385249-106385271 CAGGAAGTGCGGCCTCTTCAAGG - Intergenic
1114482590 14:23044800-23044822 GAGGAGGGGCAGCTTTTGCATGG + Intergenic
1117521527 14:56556423-56556445 CAGAAAATGTAGCTTGTGGATGG - Intronic
1118361739 14:65062899-65062921 CATGAAGTGCAGTGTGTGGAGGG - Intronic
1120080238 14:80208029-80208051 CAGGCAGTTTAGCTTCTGCACGG - Intronic
1120255514 14:82114340-82114362 CAGGAAGGGCTGCTACTGCATGG - Intergenic
1121128973 14:91428158-91428180 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1121282850 14:92711707-92711729 CAGGTGGTACTGCTTGTGCAGGG + Exonic
1122579212 14:102761211-102761233 CGGGAAGTGGAGCTGGAGCAGGG - Intergenic
1122651247 14:103228354-103228376 CCTGAAGTGCAGCCTTTGCAGGG + Intergenic
1124113359 15:26814382-26814404 CAGGCAAGACAGCTTGTGCAGGG - Intronic
1126181579 15:45790727-45790749 AAGGAAGACCAGATTGTGCAGGG - Intergenic
1128767429 15:70259734-70259756 GAGGATGTGCAGCTTGAGAATGG + Intergenic
1129676817 15:77636214-77636236 CAGGAGGTGGAGCTGGGGCAAGG + Intronic
1130247695 15:82267509-82267531 CAGGAACTTCAACTTGTGAAAGG - Intronic
1130315201 15:82789534-82789556 CAGGGAGGGTATCTTGTGCAAGG + Intronic
1130452445 15:84070001-84070023 CAGGAACTTCAACTTGTGAAAGG + Intergenic
1132078031 15:98839267-98839289 AAGGAAGTGCAGCTAGTAAATGG + Intronic
1132553572 16:563459-563481 CATGAAGTACAGCCTCTGCAAGG + Exonic
1132731972 16:1367131-1367153 CAGCGAGTGCAGCTTCGGCAGGG + Intronic
1133364192 16:5198002-5198024 CAGGAGGTGGAGCCTTTGCAAGG - Intergenic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1135987525 16:27194934-27194956 CAGGCAAAACAGCTTGTGCAGGG + Intergenic
1137020393 16:35420022-35420044 CAGGCTGTGCAGATTGAGCAGGG + Intergenic
1137295263 16:47086315-47086337 AAGAAAGTGCTGCTTGTGCAGGG + Exonic
1137765645 16:50975715-50975737 CAGGGAGAGCAACTTGGGCAAGG + Intergenic
1138566164 16:57834334-57834356 CAGGGAGTGCAGTTTGCTCAGGG - Intronic
1140996146 16:80261380-80261402 CATGTAATGGAGCTTGTGCATGG - Intergenic
1141286417 16:82676720-82676742 CAGAAAGTGCATCTCATGCAAGG - Intronic
1141854165 16:86669768-86669790 CAGGGAGTGCTCCATGTGCAAGG - Intergenic
1144789500 17:17849617-17849639 GGGGAAGAGCAGCATGTGCAGGG + Intronic
1145291595 17:21551191-21551213 CGTAAAGTGCAGCCTGTGCACGG + Exonic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1148872015 17:50663852-50663874 CAGGAAGGTCAGCTGGAGCAGGG + Exonic
1150324968 17:64249637-64249659 CAGCAAGTGTAGCAAGTGCAGGG - Intronic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1151148953 17:72067187-72067209 CAGGAAAGAGAGCTTGTGCAGGG + Intergenic
1151955111 17:77376277-77376299 CCGGGAGTGCAGCTGGTCCACGG + Intronic
1152315616 17:79578727-79578749 AAGGAAGTGCAGCTTCTTCCAGG + Intergenic
1152330083 17:79667709-79667731 CAGGAAATGCTTCTTGGGCAAGG + Intergenic
1152816544 17:82411518-82411540 CGGGGAGTGCAGCCTGTGAAGGG + Exonic
1154103388 18:11498292-11498314 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
1154493051 18:14935860-14935882 CAGGGAGTGCAGCCTGTGAAAGG + Intergenic
1155619989 18:27767678-27767700 CAGGTAGCACAGCTTGTACAAGG + Intergenic
1156053477 18:32969141-32969163 CAAGAACTGCAGCTGGTGCCAGG + Intronic
1156644766 18:39147800-39147822 CAGGCAGTGCACCCTGTGTATGG + Intergenic
1157239971 18:45999607-45999629 CAGGAAGTCCAGCATGGACAGGG + Intronic
1157940983 18:51929020-51929042 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
1158180951 18:54714378-54714400 CAGGAACTGCTGGTTCTGCAGGG - Intergenic
1158391203 18:57046639-57046661 AAGGAAGGGCAGCTTGTGCTAGG + Intergenic
1158653127 18:59305506-59305528 CTGGACGTGCAGCTGGAGCAGGG + Intronic
1158686624 18:59620695-59620717 CAGGCAGGAGAGCTTGTGCAGGG - Intronic
1159322131 18:66866449-66866471 CAGGTAAGACAGCTTGTGCAGGG + Intergenic
1159572710 18:70137537-70137559 CAGGGAGGGCAGTTCGTGCAGGG - Intronic
1159776512 18:72608893-72608915 CAGGCAAGGGAGCTTGTGCAGGG + Intronic
1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG + Exonic
1160986128 19:1839780-1839802 CAGGCACTGCTGCTTCTGCAGGG - Intronic
1161145411 19:2675291-2675313 CAGGAACAGCAGCAAGTGCACGG + Intronic
1162689074 19:12413945-12413967 CAGGAAATGGTGCGTGTGCACGG - Intronic
1163462127 19:17445318-17445340 CAGGAAGTGGAGCTGGTGGGGGG + Intronic
1163489635 19:17609626-17609648 CAGGAAGTGCATGGTGGGCAGGG - Intronic
1163758476 19:19120563-19120585 CAGGAAGTGGAGCCTGGGGATGG - Intronic
1163915991 19:20241022-20241044 CAGGAGGTGGAGGTTGTGTAAGG - Intergenic
1164886336 19:31781829-31781851 CAGGGAGGGCAGCATGTGCAGGG + Intergenic
1165708321 19:37991899-37991921 CAGGTCATGCAGCTAGTGCAGGG - Intronic
1167637035 19:50661304-50661326 AAGGAAATGCAGCGTGTGCGAGG + Intronic
925101432 2:1249891-1249913 CGGGCAGTGCAGCATTTGCAAGG + Intronic
925783229 2:7403103-7403125 AAGGAAGTGCATTTTCTGCAGGG - Intergenic
926793926 2:16603239-16603261 CAGACAGAGCAGCATGTGCAAGG - Intronic
928768835 2:34680609-34680631 CAGGAGATGCAGCTTCTCCATGG - Intergenic
929060455 2:37919018-37919040 CAGGAAGTGAAGCCTGTGAGAGG + Intergenic
930863005 2:56093891-56093913 CAGCTACTGAAGCTTGTGCATGG - Intergenic
930979355 2:57503926-57503948 CAGGTAGGAGAGCTTGTGCACGG + Intergenic
932246957 2:70204127-70204149 GAGGAGGTGCAGATAGTGCATGG + Intronic
932421689 2:71605014-71605036 CAGGAAGTGAGGCTGTTGCATGG + Intronic
932568492 2:72924323-72924345 CAGGACGGGCTGCTTCTGCACGG + Exonic
933450651 2:82445963-82445985 CAGTAATTGCAGTTTTTGCATGG + Intergenic
933813388 2:86047467-86047489 GAGGAAGTCCAGCGAGTGCAGGG - Intronic
934514212 2:94974756-94974778 CAGGAAGTGCTGGTTGTGATGGG + Intergenic
935813860 2:106827956-106827978 CAAGAAGTTGAGGTTGTGCAGGG - Intronic
936172331 2:110186773-110186795 CAGGCAGTGTGGTTTGTGCAAGG - Intronic
938139978 2:128787373-128787395 CAGGAGGTGCAGCAGGCGCAGGG - Intergenic
939982363 2:148796842-148796864 CAGGAAAAGCAGCTTCTGAAGGG - Intergenic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
943139791 2:183967947-183967969 ATGGAAGTGCATCCTGTGCAGGG - Intergenic
943224457 2:185151745-185151767 CAGGAAAGAAAGCTTGTGCAAGG - Intergenic
943245849 2:185450443-185450465 AAAGAAGTAAAGCTTGTGCAGGG + Intergenic
944517097 2:200523207-200523229 CAGGAAGTGCATTTTGAGCTAGG - Intronic
944643576 2:201754518-201754540 AAGGAAGGGCAGCTGGGGCACGG - Exonic
944891952 2:204127048-204127070 CAGGCAGGGGAGCATGTGCAGGG - Intergenic
945664563 2:212724563-212724585 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
946024099 2:216661508-216661530 AAAGAAGTGGAGCTTGGGCATGG + Intronic
946424311 2:219584596-219584618 CAGGAACTGCACCTTGTGGGAGG + Intergenic
946656351 2:221952176-221952198 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
946769248 2:223071653-223071675 CAGGTAAGACAGCTTGTGCAGGG + Intronic
948461024 2:238130098-238130120 CAGGAAGGGCAGGGTGAGCAGGG - Intronic
948925216 2:241091889-241091911 CAGGAACTGCAGCTTGGGTGAGG - Exonic
948995819 2:241577703-241577725 CAGGAGGGGCACCTTGAGCATGG - Intergenic
1169200437 20:3706655-3706677 CAGGACGTGCAGGGTGTGAAGGG - Exonic
1170890116 20:20368941-20368963 CTCGAAGTGCAGCTTGCGGATGG - Exonic
1171152002 20:22835486-22835508 GAGGAAGAGCAGCTTGAGCTAGG + Intergenic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172180486 20:33000550-33000572 CAGGAAGAACAGCATGTGCTGGG + Intronic
1175514957 20:59563429-59563451 CAGAAGGGGCAGCTTCTGCATGG - Intergenic
1175527370 20:59644703-59644725 CAGGAGGTGCAGCCTGTGCCTGG - Intronic
1175900575 20:62358411-62358433 CAGGAAGTGCAGCTGCGGCCAGG - Intronic
1177769873 21:25502491-25502513 CAGGCAATGGAGCTTGTGCAGGG + Intergenic
1177903964 21:26952530-26952552 CAATAAGTGCAGCTTCTTCAGGG - Intronic
1177976216 21:27854333-27854355 CAGGAAAAAGAGCTTGTGCAGGG - Intergenic
1178498345 21:33105524-33105546 CAGGAAGTGCAGATAATACAAGG - Intergenic
1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG + Exonic
1180782392 22:18528578-18528600 CAGGCAGCGCAGCCTCTGCAAGG + Exonic
1180967650 22:19798939-19798961 CAGGAGGAGAGGCTTGTGCAGGG - Intronic
1181125945 22:20702605-20702627 CAGGAAGCGCTGCTTCTGCAAGG + Intergenic
1181148630 22:20866702-20866724 CAGAGGGTGCAGCTTGTGCAGGG - Intronic
1181239281 22:21467913-21467935 CAGGCAGCGCAGCCTCTGCAAGG + Intergenic
1182055928 22:27354535-27354557 CAGGAAGCTCAGCAGGTGCAAGG - Intergenic
1182123296 22:27800275-27800297 CTGCAAGCGCAGCCTGTGCACGG - Exonic
1183110721 22:35646715-35646737 CAGGAAGTGCTGCTTATGTAAGG - Intergenic
1183861965 22:40676862-40676884 CAGGAAGGGCAGATTCTGCCAGG - Intergenic
1184041577 22:41947038-41947060 CAGGCCGGGCAGCTTGTCCAGGG + Exonic
1185173585 22:49306919-49306941 CAGGCAGTGCAGGCTGTGCCCGG - Intergenic
949679372 3:6495167-6495189 GAGGAAATCCAGCATGTGCAGGG + Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
950105477 3:10385717-10385739 TAGGCAGTGCAGCGTGGGCACGG + Intronic
950480781 3:13242521-13242543 CGGGATGTGCAGCTAGTGGAAGG - Intergenic
950664083 3:14484381-14484403 CAGGAAGTGTAGCTTATGGGAGG + Intronic
951134943 3:19094457-19094479 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
951304991 3:21048618-21048640 CAGGAAATGCAGCTTTTAGATGG - Intergenic
952620193 3:35328909-35328931 CAGGCAAGGCAGCATGTGCAGGG + Intergenic
952804123 3:37330648-37330670 CAGGAAGTGGAGGGTGGGCAAGG + Intronic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
960157194 3:114307999-114308021 CAGCAGGTGCAGCTTCTGCCTGG - Exonic
960255237 3:115504845-115504867 CAGGCAGGAGAGCTTGTGCAGGG - Intergenic
962285085 3:134078516-134078538 CAGAAAGTGGGGCTTGTGCTTGG - Intronic
962929749 3:140025421-140025443 CAGGATGAGCAACTTGTGGAAGG - Intronic
963177196 3:142312217-142312239 CAGGGAGTCGAGATTGTGCATGG + Intronic
964736746 3:159925951-159925973 CAGGGAGCTCAGCTTGTGCATGG - Intergenic
966270242 3:178096320-178096342 AAGGAACAGAAGCTTGTGCAGGG - Intergenic
966669756 3:182513787-182513809 TAGAGAGTGAAGCTTGTGCAGGG - Intergenic
967122729 3:186397728-186397750 CAGGAAGTGAAGGTTGTGAAGGG + Intergenic
967670367 3:192226617-192226639 CAGGAAGTGGAACCTTTGCAAGG + Intronic
968685918 4:1958500-1958522 GAGGAAGTGCAGCCAGGGCAGGG + Intronic
969338911 4:6528237-6528259 CCGGAAGGCCAGCTTGTGCGGGG + Intronic
969491216 4:7500201-7500223 CAGGCTGGGCAGCTCGTGCAGGG - Intronic
970536857 4:17038684-17038706 GAGGAAGTCCAGGCTGTGCAAGG - Intergenic
971000013 4:22311412-22311434 CGGGTAGTGCAGCTTCTGCATGG + Intergenic
971814990 4:31476140-31476162 CAGAAAGGAGAGCTTGTGCAGGG + Intergenic
972322256 4:37982894-37982916 CGGGAAGGGCAGGTTGTGCCAGG + Intronic
972326455 4:38021167-38021189 CAGGCAGGGCAGCGTGTGCAGGG + Intronic
972583844 4:40419027-40419049 CAGGCAGGGCAGCATGTGCAGGG + Intergenic
974062407 4:57047262-57047284 CAGGCAGGACAGCATGTGCAGGG - Intronic
974595795 4:64013287-64013309 CTGGAAGTGATGCTTCTGCAGGG - Intergenic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
976924176 4:90476230-90476252 CAGGAAATGCATCTTATGTAAGG - Intronic
979038252 4:115753535-115753557 CAGGCAGGAGAGCTTGTGCAGGG - Intergenic
979506903 4:121509488-121509510 CAGAAAGTGCAGTTTGTGAAGGG - Intergenic
982587538 4:157261190-157261212 CAGGCAATAGAGCTTGTGCAGGG + Intronic
983146550 4:164223001-164223023 CAGGGAAGGGAGCTTGTGCAGGG + Intronic
984329027 4:178291486-178291508 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
984562768 4:181290480-181290502 CAGGCTGTGCAGCTTATGCCAGG + Intergenic
985682591 5:1264367-1264389 CCGGAAGTGGAGCCTGTGCCCGG - Intronic
986691293 5:10315987-10316009 CAGGAAGGGCAGCCTTTCCAGGG - Intergenic
986761823 5:10886974-10886996 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
986864894 5:11974648-11974670 CAGGCAAGGGAGCTTGTGCAGGG + Intergenic
987457436 5:18164773-18164795 CAGGCAGGAGAGCTTGTGCAGGG + Intergenic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
988636512 5:32990036-32990058 TGGGAAGTGCAGCCTGTGCGTGG + Intergenic
988818876 5:34861328-34861350 GATGAAGTTCAGATTGTGCAAGG - Intronic
989393661 5:40929389-40929411 CAGTAAGTTCAGATTGTTCAAGG + Intronic
989744057 5:44806917-44806939 TAGAAAGTGCAGCTAGTACAGGG - Intergenic
989747875 5:44852974-44852996 CAGGAAAGAGAGCTTGTGCAGGG + Intergenic
993017245 5:82548437-82548459 GAGGATGTGCAGCTTGTGTGGGG + Intergenic
993200933 5:84813800-84813822 CAGGAAAGACAGCATGTGCAGGG - Intergenic
995075076 5:107973126-107973148 CAGGAAATGGAGCCTGTTCAGGG + Intronic
995840798 5:116441514-116441536 TAGGAAGCCCAGCTTGTGAAGGG + Intergenic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997353103 5:133244796-133244818 CAGGAAGTTCAGCCTGGGCCTGG - Intronic
997471470 5:134119746-134119768 AAGGAAGTGCTGCTGATGCACGG + Intronic
998391803 5:141791923-141791945 GAGGAAGTGCAGCTAGTGTAGGG + Intergenic
998766509 5:145493638-145493660 CAGGTAGAGTAGCTTGAGCAAGG - Intronic
998809336 5:145950334-145950356 CAGCAATGGCAGCTAGTGCAGGG - Intronic
1001269475 5:170300774-170300796 CAGAAAGGGCAGCTGGTGCAAGG + Intergenic
1002797481 6:486367-486389 CAGGAAGAGCTGCTTCTGCAGGG - Exonic
1003241728 6:4351044-4351066 AAGGAGGTGGAGTTTGTGCATGG + Intergenic
1005137836 6:22591512-22591534 CAGGCAAGGGAGCTTGTGCAGGG + Intergenic
1005534621 6:26743325-26743347 CAGAGAGGGCAGCTTTTGCAAGG + Intergenic
1005570213 6:27138208-27138230 CAGGAACTGCTACTGGTGCAGGG + Intergenic
1006516440 6:34548215-34548237 GAGGCTGTGCAGCTTGTCCAGGG + Intronic
1006756674 6:36422323-36422345 CAGAGGGAGCAGCTTGTGCAAGG - Intronic
1007140777 6:39571414-39571436 CAGGAGTTGCAGCTTTAGCAGGG - Intronic
1007918960 6:45588805-45588827 CATGAAGTGTAGTGTGTGCAAGG + Intronic
1011055303 6:83197678-83197700 CAGACAGTGCTGCTTGTGCTGGG + Exonic
1012213620 6:96556051-96556073 AGGGAAGAGGAGCTTGTGCAGGG + Intergenic
1014528020 6:122523806-122523828 CAGGAAAGAGAGCTTGTGCAGGG - Intronic
1016309896 6:142723152-142723174 GAGGTTGTGCAGCCTGTGCAGGG - Intergenic
1016384925 6:143521609-143521631 CAGAGAGGGCAGCTTGGGCAAGG + Intergenic
1017450441 6:154549871-154549893 CAGGAAGAGGAGCTTGAGGATGG + Intergenic
1018060938 6:160089174-160089196 CAGGAGGTGCAGATGGTGAATGG + Exonic
1018293456 6:162317338-162317360 CAGGCAGGAGAGCTTGTGCAGGG - Intronic
1018899198 6:168042809-168042831 CAGGAGGTGCAGGGGGTGCATGG - Intronic
1022514468 7:30966481-30966503 CAGAAAGCACAGCATGTGCAAGG - Intronic
1022559867 7:31336706-31336728 CGGGCAGTGCAGCCTGTGCCCGG + Intergenic
1023035667 7:36129366-36129388 CAGTCAGTGGAGCATGTGCAGGG + Intergenic
1024231152 7:47364705-47364727 CAGGACGTGCCTCTTGTGCTAGG - Intronic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1025731837 7:64114556-64114578 GAGGAAGTGCAGCTTCGACAGGG + Intronic
1025923501 7:65937326-65937348 CAGGAAGAGCAGCTTGTAGTGGG + Intronic
1025928040 7:65974736-65974758 GAGGAAGTGCAGCTTCGACAGGG - Intronic
1028054748 7:86227341-86227363 CAAGAAGGGTAGCTTTTGCATGG + Intergenic
1028401391 7:90429416-90429438 CAGGCAAGACAGCTTGTGCAGGG - Intronic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1029331231 7:99857550-99857572 CAGGAAGTGGAGGCTGGGCATGG + Intronic
1029361166 7:100089394-100089416 CAGGAGGGGCGGCCTGTGCAGGG + Exonic
1030006641 7:105126756-105126778 CAGGAAGAGCCGCTGGTGTAGGG + Intronic
1030125428 7:106148622-106148644 CTGGAAGTGTTGTTTGTGCATGG + Intergenic
1030784626 7:113644812-113644834 CAGGCAAGACAGCTTGTGCAGGG + Intergenic
1031271269 7:119652606-119652628 CAGAATGTGAACCTTGTGCAGGG + Intergenic
1032584657 7:133135059-133135081 TAGGAAGTGCAGCCTATGGAAGG - Intergenic
1033238750 7:139659485-139659507 CTGCAGCTGCAGCTTGTGCACGG + Intronic
1033520009 7:142150907-142150929 AAGGAAGGCCATCTTGTGCACGG - Intronic
1033606650 7:142932638-142932660 CAGGAAGAGCAGCTGGGGCAGGG - Intronic
1033929868 7:146508135-146508157 GAGGAGGTGCAGATAGTGCATGG - Intronic
1035221295 7:157407946-157407968 CAGGAAGTGCTGTGTGTGCATGG + Intronic
1035964000 8:4169796-4169818 CAGAAAGTGCTGCTGGTGGAAGG - Intronic
1036207970 8:6819194-6819216 CAGGAATTGCAGCTTCTTCTGGG + Intronic
1036226262 8:6960272-6960294 CAGGAGGTGGAGCTTGTGATTGG + Intergenic
1036290077 8:7479939-7479961 CAGGAAAGACAGCGTGTGCAGGG - Intergenic
1036331399 8:7831584-7831606 CAGGAAAGACAGCGTGTGCAGGG + Intergenic
1038229114 8:25684350-25684372 TGGGAAGTGCAGTTTGGGCAGGG + Intergenic
1038669347 8:29569981-29570003 CAGGTAAGACAGCTTGTGCAGGG + Intergenic
1040973228 8:53160543-53160565 CAGGCAAGACAGCTTGTGCACGG - Intergenic
1044324970 8:90848652-90848674 CAGGCAAGACAGCTTGTGCAGGG + Intronic
1045207569 8:100057611-100057633 CAGGCAAGACAGCTTGTGCAGGG - Intronic
1045932580 8:107644225-107644247 CAGGCAGGAGAGCTTGTGCAGGG - Intergenic
1046232436 8:111374600-111374622 CAGGAAAGACAGCTTGTTCAGGG - Intergenic
1047810056 8:128398817-128398839 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
1048375389 8:133818454-133818476 CAGGCAAGACAGCTTGTGCAGGG - Intergenic
1049268674 8:141682825-141682847 CAGGAGATGCAGCTTGTGAAGGG + Intergenic
1049462838 8:142738112-142738134 CAGGGTGTTCAGCTTCTGCATGG - Intergenic
1051017121 9:12491837-12491859 CAGGCAATAGAGCTTGTGCAGGG - Intergenic
1052690908 9:31815832-31815854 AAGGAAGAGGAGCTTTTGCAAGG - Intergenic
1053345280 9:37373536-37373558 CAGGAGGAGCAGCACGTGCAAGG + Intergenic
1055880023 9:80989722-80989744 CAGGAAATGGTGCTTTTGCATGG - Intergenic
1056486087 9:87059328-87059350 CAGGCAAGGCAGCATGTGCAGGG - Intergenic
1057787262 9:98096363-98096385 CAGGAAGTCCAGGGTGGGCAGGG + Intronic
1059558439 9:115306736-115306758 CAGGCAAGACAGCTTGTGCAGGG + Intronic
1059810268 9:117849086-117849108 CAGGAAGTGCTGCTTCAGCCAGG - Intergenic
1061756103 9:132813567-132813589 GAGGAGCTGCAGCATGTGCAGGG + Intronic
1062453989 9:136627185-136627207 CAGGAAGCCCAGCTGGAGCACGG + Intergenic
1062514575 9:136926167-136926189 CAGCAAGGGCAGCTTGTGCTGGG - Exonic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1185797606 X:2980384-2980406 CAGGCAGCAGAGCTTGTGCAGGG - Intergenic
1186477994 X:9873602-9873624 CAGGAATTGCTGCTCGTGGAAGG + Intronic
1186825947 X:13340235-13340257 CAGAACGTCCAGCTTTTGCAGGG - Intergenic
1186932623 X:14411541-14411563 CAGGAAATGCAGCTGGTGAGGGG - Intergenic
1187192091 X:17044823-17044845 CAGGAAGTGCTGCTAGGGCATGG + Intronic
1188169786 X:26910763-26910785 CAGGAAAGAGAGCTTGTGCAGGG - Intergenic
1188896542 X:35675786-35675808 GAGGAAATGCACCTTCTGCAAGG - Intergenic
1190534461 X:51411894-51411916 CAGGAAGTGTAGCTGGTGGCTGG + Intergenic
1191602809 X:63028073-63028095 CAGGCAGTAGAGCTTGTGCAGGG + Intergenic
1193199132 X:78666893-78666915 TAGGAACTTCAGCTTGTGAATGG + Intergenic
1194024705 X:88737243-88737265 CAGGCAAGACAGCTTGTGCAGGG + Intergenic
1195017290 X:100792004-100792026 CAGGAAGTTCAGATTGGTCAGGG - Intergenic
1198652178 X:138874943-138874965 GAGAAAGTGCAGCTTGTGACTGG + Intronic
1198684039 X:139208960-139208982 CTGGAAGTGTAGCTTTTGCCAGG - Intronic
1199193168 X:144996346-144996368 CAGGCAAGGGAGCTTGTGCAGGG - Intergenic
1199782455 X:151074917-151074939 CAGGAAGAGCAGGTTTTGAAAGG - Intergenic
1201716061 Y:17045115-17045137 CAGGAAGTGTGTCCTGTGCAAGG + Intergenic