ID: 1029105469

View in Genome Browser
Species Human (GRCh38)
Location 7:98171697-98171719
Sequence CACGCCCCACACAGCACCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 6, 3: 4, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029105465_1029105469 8 Left 1029105465 7:98171666-98171688 CCTGCACAGGTGGGTACCTGCGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG 0: 1
1: 0
2: 6
3: 4
4: 99
1029105461_1029105469 27 Left 1029105461 7:98171647-98171669 CCATGCACAAGCTGCACTTCCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG 0: 1
1: 0
2: 6
3: 4
4: 99
1029105460_1029105469 30 Left 1029105460 7:98171644-98171666 CCGCCATGCACAAGCTGCACTTC 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG 0: 1
1: 0
2: 6
3: 4
4: 99
1029105467_1029105469 -8 Left 1029105467 7:98171682-98171704 CCTGCGTCAGCGGTGCACGCCCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG 0: 1
1: 0
2: 6
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029105469 Original CRISPR CACGCCCCACACAGCACCGG CGG Intronic
900487611 1:2930913-2930935 CACCCCCCACACAGCACAGGAGG - Intergenic
900510039 1:3054519-3054541 CAGACCCCACACAGCCCCGCCGG + Intergenic
905873090 1:41416130-41416152 CCCGCCCCACTCAGCCCTGGTGG - Intergenic
906902133 1:49846279-49846301 CCCACCTCACACAGCACTGGAGG + Intronic
907456740 1:54581199-54581221 CAGCCTCCACACAGCACCAGAGG - Intronic
909957874 1:81801532-81801554 CACGCCACACACAGCAGCGGAGG - Intronic
911041759 1:93596878-93596900 CTCACCCCACACAGCAGCTGTGG + Intronic
916192393 1:162192131-162192153 CAGGCCCCACCCAGCACCTGTGG + Intronic
917499772 1:175575740-175575762 CCCGCACCACAGTGCACCGGGGG + Intronic
922764268 1:228149378-228149400 CACACCACACACAGCCCCTGGGG - Intergenic
1062798728 10:363534-363556 GAGGCCACACACAGCACCCGCGG + Intronic
1063464095 10:6232012-6232034 CCCACCCCACACAGAACTGGGGG - Intronic
1067057241 10:43059356-43059378 AAAGCCCCTCACAGCACAGGAGG + Intergenic
1070856577 10:79611869-79611891 CACTTCGCACACAGCACCAGAGG - Exonic
1071384686 10:85107325-85107347 CAGACCACACACAGCACAGGTGG - Intergenic
1077049129 11:558875-558897 CACGCCCCACCCCGCACCGGTGG - Exonic
1077112098 11:866386-866408 CACGCCCCACCCAACCCCTGTGG - Intronic
1079517316 11:21284482-21284504 CACCTCCCCCACAGCACTGGAGG - Intronic
1081528304 11:43942203-43942225 CGCGCCCCGCGCAGAACCGGCGG + Intronic
1083428587 11:62602163-62602185 CCCACCCCACAGAGCCCCGGAGG + Intergenic
1086956561 11:92939907-92939929 CATGCCCCACACAGGAGTGGGGG - Intergenic
1089601911 11:119621557-119621579 AACACCGCACACAGCACTGGGGG + Intergenic
1091288398 11:134422404-134422426 CCTGCCTCACACAGCAGCGGGGG - Intergenic
1096514350 12:52148012-52148034 CAGGCCACACAGAGCACCTGAGG - Intergenic
1099365133 12:81758875-81758897 GACGCCCCACACACCCCGGGTGG - Intronic
1104720973 12:131045124-131045146 CACGCCTCCCACACCACCCGCGG + Intronic
1104820149 12:131672423-131672445 CACGCCACACCCAGCACCTGTGG - Intergenic
1108826245 13:54416016-54416038 CAAGCTCCACACAGCACTTGCGG + Intergenic
1113310027 13:109122106-109122128 CAGGCCCCACCCAGGACCTGTGG + Intronic
1118256329 14:64209130-64209152 CACACCCCACACAGGACAGCTGG - Intronic
1122355846 14:101122451-101122473 CACGGCCCACCCACCACCTGAGG + Intergenic
1122971045 14:105152371-105152393 CACGCCACACCCAGGGCCGGCGG + Intronic
1123035991 14:105472156-105472178 CAGGCCCCACCCAGCACCGGTGG - Intergenic
1126753406 15:51900337-51900359 CAAGCCCTACACAGCAGCGTGGG - Intronic
1129790829 15:78339823-78339845 CACGCCCCCCACAGGACCCATGG - Intergenic
1131058667 15:89391233-89391255 CACTCCCCACCCACCACCTGGGG - Intergenic
1132604507 16:788177-788199 CGCGCCCCGCACAGGCCCGGTGG + Intronic
1134056254 16:11171461-11171483 CTCTCCCCACAGAGCACTGGAGG - Intronic
1139481947 16:67235696-67235718 CACACACCACACAGCACCCTAGG + Intronic
1139599381 16:67977405-67977427 CAGGGCCCCCACAGCACAGGAGG - Intronic
1141961400 16:87411737-87411759 CACGCCCCTTACAGCAGCAGCGG - Exonic
1142038653 16:87878431-87878453 CACGCCCGACACAGCAAGTGTGG - Intergenic
1142709194 17:1714515-1714537 TCCGCCCCTCACAGCCCCGGGGG - Intergenic
1148807327 17:50270556-50270578 GACGCCACACCCAGCACAGGTGG - Intergenic
1152130372 17:78472615-78472637 CACCCCACACACAGCCCCCGGGG - Intronic
1152357594 17:79814311-79814333 CACTCCCCACACAGCAGCCCAGG - Intergenic
1154356620 18:13626712-13626734 CAGGCCCCACCCAGCACAGCTGG + Intronic
1160534845 18:79586265-79586287 CACGCCCCTCCCAGCCCCTGTGG + Intergenic
1160877741 19:1305045-1305067 GCCGCCCCCCACAGCCCCGGTGG + Intergenic
1161388652 19:4009964-4009986 TAGGCCCCTCAGAGCACCGGGGG - Intronic
1161435425 19:4259949-4259971 CACTACCCACACAGCCCTGGGGG + Intronic
1161441202 19:4292632-4292654 CAAGCCCCACCCAGCAGCCGAGG - Exonic
1165064159 19:33219435-33219457 CATTCCCCACACACCACAGGAGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167410144 19:49339542-49339564 GCCGCTCCACCCAGCACCGGAGG + Intronic
1167556996 19:50203128-50203150 CACGGCCCACACCTCCCCGGTGG + Intronic
1168550744 19:57291251-57291273 CACACCTCACACGGCACCAGCGG + Exonic
1168554711 19:57328265-57328287 CACACCTCACACGGCACCAGCGG + Exonic
1168647351 19:58068340-58068362 CCCACCTCACTCAGCACCGGAGG + Exonic
925084949 2:1100613-1100635 CACGCCCGACACAGCAACGGTGG - Intronic
925281883 2:2690657-2690679 CACACCCCAAATAGCACCTGAGG + Intergenic
928087696 2:28356157-28356179 CAGGCCCCACAGAGCAGCGAAGG + Intergenic
934554036 2:95278109-95278131 CACCCACCACACAGCACCCTGGG + Intronic
946035981 2:216742594-216742616 CAAGCCCCACACAGGGCCAGGGG + Intergenic
947749944 2:232526684-232526706 CCCTCCCAACCCAGCACCGGAGG - Intronic
947819525 2:233060416-233060438 CAGGACCCACACACCACCGAGGG - Exonic
948037853 2:234873635-234873657 CAGGCCAGGCACAGCACCGGAGG - Intergenic
948154355 2:235769302-235769324 CACGCCCCACTCAGCAGCCCAGG - Intronic
1174486878 20:50866709-50866731 CCAGCCCCACACAGCTCCGGGGG + Intronic
1175167375 20:57054376-57054398 CACAACCCACACAGAATCGGAGG + Intergenic
1175819816 20:61902864-61902886 CACACCACACACAGCAGAGGTGG + Intronic
1178920855 21:36737298-36737320 CACGCCTCACCCACCACCTGAGG + Intronic
1180188100 21:46150349-46150371 CTCGCCCCTCACAGCAGCAGCGG + Intronic
1180831573 22:18909646-18909668 CAGCCCCTACACAGCACCAGAGG - Intronic
1181340090 22:22171828-22171850 CATGTCCCATGCAGCACCGGTGG + Intergenic
1183315281 22:37133653-37133675 CACGCTCCACACAGCAGCCAGGG + Intronic
1185315399 22:50176802-50176824 CTCCTCCCACACAGCACCTGCGG - Intronic
1203281657 22_KI270734v1_random:134917-134939 CAGCCCCTACACAGCACCAGAGG - Intergenic
950176442 3:10878070-10878092 CACTCCCCACCCAGCAACAGAGG + Intronic
950331383 3:12158752-12158774 CATGCCTCACCCAGCCCCGGGGG + Exonic
950784910 3:15426613-15426635 CACGCCTCAAACAGCACAGGGGG + Exonic
955053524 3:55435440-55435462 CACGGCCCACAGAGCACTGTGGG + Intergenic
962343026 3:134601279-134601301 CCCGCCCCTCAAAGCACCGCAGG - Intronic
968052906 3:195668356-195668378 CACCCCACACACATCACTGGGGG - Intergenic
968102903 3:195980007-195980029 CACCCCACACACATCACTGGGGG + Intergenic
974003265 4:56531240-56531262 CACGCCCCATCTAGAACCGGGGG + Intronic
978371151 4:108030426-108030448 CCCGCCCTACACAGCACCTTGGG - Intronic
982668832 4:158296670-158296692 CAAGCCCCAAACATCACCTGGGG + Intergenic
987091179 5:14509066-14509088 CACCCCCCACCCACCACCTGGGG + Exonic
993877551 5:93326137-93326159 CACGGCCCACACAGCTCCACCGG + Intergenic
997242251 5:132315929-132315951 GACGCCCCAGTCAGCACCTGGGG + Intronic
997267081 5:132501208-132501230 CACGCCCCATCCAGCAGTGGAGG - Intergenic
997943511 5:138179366-138179388 CACCACCTCCACAGCACCGGCGG + Intronic
1001948732 5:175801195-175801217 CACTCTCCACACAGCAACAGAGG - Intronic
1002924004 6:1594590-1594612 CACGCCCCTCCCAGCACCCAGGG + Intergenic
1007285165 6:40742444-40742466 CATGGCCCACACAGCACCATGGG + Intergenic
1007763418 6:44147467-44147489 CTCGCACCACACAGCAGCAGAGG - Exonic
1019760454 7:2808546-2808568 CACTCCCCACAGAGCAGCAGCGG + Intronic
1028268628 7:88759468-88759490 CTCTCCCCACAAAGCAGCGGCGG + Exonic
1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG + Intronic
1032182438 7:129691928-129691950 CACGCCCCAAACAGAACCTTTGG + Intronic
1035071603 7:156148916-156148938 CACACCCCACACAGCACACAAGG - Intergenic
1036821419 8:11942854-11942876 CACAGCACACACAGCACCTGGGG + Intergenic
1040336831 8:46420352-46420374 CCCGCCCCAGACAGCCCTGGGGG - Intergenic
1049643758 8:143727115-143727137 CTCGCCCCCCACGGCACCTGGGG + Exonic
1057441050 9:95083730-95083752 CACGCACCACACAGCACCCGCGG + Intronic
1061995827 9:134182436-134182458 CACACACCACACAGCACATGGGG - Intergenic
1062443560 9:136584074-136584096 CCCGCCCCTCCCAGCTCCGGTGG - Intergenic
1190152110 X:47957376-47957398 CCCGCCCCACACAGATCCCGTGG - Intronic
1195136485 X:101911952-101911974 CCCACCTCACTCAGCACCGGAGG + Intronic