ID: 1029105827

View in Genome Browser
Species Human (GRCh38)
Location 7:98174905-98174927
Sequence GCGTTTCCACTCTCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029105827_1029105832 -4 Left 1029105827 7:98174905-98174927 CCCCAGCAGGAGAGTGGAAACGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1029105832 7:98174924-98174946 ACGCATGTTCTCATTTGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 96
1029105827_1029105830 -9 Left 1029105827 7:98174905-98174927 CCCCAGCAGGAGAGTGGAAACGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1029105830 7:98174919-98174941 TGGAAACGCATGTTCTCATTTGG 0: 1
1: 0
2: 1
3: 10
4: 119
1029105827_1029105831 -5 Left 1029105827 7:98174905-98174927 CCCCAGCAGGAGAGTGGAAACGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1029105831 7:98174923-98174945 AACGCATGTTCTCATTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029105827 Original CRISPR GCGTTTCCACTCTCCTGCTG GGG (reversed) Intronic
900166436 1:1245927-1245949 GGGCTTCCTCTCTCCTGCTCAGG - Intronic
901129228 1:6951757-6951779 GCCTGTCCCCTTTCCTGCTGAGG + Intronic
901636610 1:10673495-10673517 ACGCTGCCTCTCTCCTGCTGGGG + Intronic
903351118 1:22717089-22717111 TCTTTTCCAGTTTCCTGCTGAGG - Intronic
904091602 1:27948870-27948892 GCTTTGCCATTTTCCTGCTGTGG - Intronic
904434630 1:30486180-30486202 AACTTTTCACTCTCCTGCTGTGG - Intergenic
905482844 1:38273385-38273407 GCGCTTCCACTCCCTTGCTCTGG - Intergenic
912664592 1:111567737-111567759 GCCTTTCCACTGCCCTGCAGAGG - Intronic
913691246 1:121281776-121281798 CCTTTTCCACTTTCCAGCTGAGG - Intronic
914146297 1:144998205-144998227 CCTTTTCCACTTTCCAGCTGAGG + Intronic
915953850 1:160207371-160207393 CTGTTTCCACTCTTCTGGTGTGG - Intronic
916657531 1:166889952-166889974 GTGTTTCCAGTCTTTTGCTGTGG - Intergenic
920131725 1:203737145-203737167 GCTTTTCCTCTCACCTGTTGGGG - Intronic
920478570 1:206300252-206300274 CCTTTTCCACTTTCCAGCTGAGG - Intronic
1065951901 10:30659838-30659860 GCCCTACCAGTCTCCTGCTGGGG + Intergenic
1072709905 10:97709397-97709419 GCGTTTGCACTCTGCTGGTAGGG - Intergenic
1076207912 10:128617903-128617925 CCCTTCCCACTCACCTGCTGAGG + Intergenic
1076770661 10:132662395-132662417 CTGTTCCCACTCACCTGCTGTGG - Intronic
1077139064 11:1015596-1015618 GCGTTTCCACTCTCCTCTCCTGG - Intronic
1078614334 11:12851235-12851257 CCGTTTCCTCTCTCCTCCTCTGG - Intronic
1079567176 11:21897373-21897395 TCATTTTCACTCTCCTTCTGTGG - Intergenic
1080133323 11:28822524-28822546 GAGTTTCTACTCTCCAGTTGGGG + Intergenic
1080695279 11:34598275-34598297 GTGTATCCATTCTCCTACTGAGG + Intergenic
1083731587 11:64655220-64655242 TCGCCTCCACTCTTCTGCTGCGG - Intronic
1084870497 11:72095450-72095472 GCGTTTCCAGACTTCAGCTGTGG - Intronic
1088928647 11:114327225-114327247 GCCTTGTCACTCTACTGCTGGGG - Intergenic
1089200593 11:116722557-116722579 GAGCTCCCACTCTGCTGCTGTGG - Intergenic
1089792944 11:120957434-120957456 GCGTTTTCCCACACCTGCTGAGG - Intronic
1092812447 12:12284398-12284420 GTGTTTCCCCCCTCCTCCTGAGG - Intergenic
1099752344 12:86791935-86791957 CCGTCTCCCCTCTGCTGCTGAGG - Intronic
1100748556 12:97672303-97672325 ACATTTCCACACTCCTACTGAGG - Intergenic
1102654154 12:114466346-114466368 GTTTTTCCACTCTCCTACTAAGG - Intergenic
1104131412 12:125897880-125897902 GTGACTCCACACTCCTGCTGAGG - Intergenic
1104355014 12:128077574-128077596 GCGGTGCCACTATCCTGGTGAGG - Intergenic
1105213562 13:18271857-18271879 GACTTGCCACTCACCTGCTGTGG + Intergenic
1107733801 13:43374842-43374864 TGGTTTACACTATCCTGCTGGGG + Intronic
1108019030 13:46106422-46106444 GTGTTTCCACTCACCTCCCGTGG - Intergenic
1113859527 13:113472188-113472210 GTGTTTCCCTTCTCCTGCTCTGG - Intronic
1113980265 13:114268785-114268807 GGGTTTTCACTCTGCTGCTTAGG - Intronic
1114666168 14:24378264-24378286 GCCTCTCCACTCTCCTCCTTGGG + Exonic
1119493343 14:75057013-75057035 GCCTTTTCTTTCTCCTGCTGTGG - Intronic
1122260716 14:100520189-100520211 TTGTTTCCACACTCCTTCTGTGG + Intronic
1122619408 14:103046226-103046248 GAGTTTCCAGTCTCCTGCTTGGG - Intronic
1125607779 15:40951833-40951855 TCTTTTCCACTCACCAGCTGTGG - Intergenic
1129106239 15:73309265-73309287 GCCTTTGCACTGGCCTGCTGGGG - Intergenic
1129170342 15:73803759-73803781 GGGTTTGCAGTCTGCTGCTGGGG - Intergenic
1130919744 15:88334158-88334180 GCCTTGCCTGTCTCCTGCTGGGG + Intergenic
1134056487 16:11173460-11173482 TGGTCTCCGCTCTCCTGCTGTGG + Intronic
1136299754 16:29326185-29326207 GCATCTCCACTCTTCTGCAGAGG - Intergenic
1136631334 16:31490756-31490778 GCCTTTCCCCTGTCCTGCTGTGG + Exonic
1136686158 16:31996087-31996109 GCCTCTTGACTCTCCTGCTGGGG - Intergenic
1136786771 16:32939616-32939638 GCCTCTTGACTCTCCTGCTGGGG - Intergenic
1136883001 16:33914174-33914196 GCCTCTTGACTCTCCTGCTGGGG + Intergenic
1139489436 16:67278782-67278804 GCTTCTCCACTTACCTGCTGGGG - Exonic
1203089007 16_KI270728v1_random:1201286-1201308 GCCTCTTGACTCTCCTGCTGGGG - Intergenic
1144209148 17:13000142-13000164 GGGCTCCCACTCACCTGCTGGGG + Exonic
1147147120 17:38491755-38491777 GCCTCTTGACTCTCCTGCTGGGG - Intronic
1147842112 17:43379090-43379112 GTGTTTCCACTTCCCAGCTGGGG - Intergenic
1153923161 18:9809016-9809038 GACTTTCCACTGTGCTGCTGAGG + Intronic
1155885844 18:31207120-31207142 ACATCTCCACCCTCCTGCTGCGG + Intergenic
1161174897 19:2835848-2835870 GAGTTTTCACTCTGTTGCTGAGG + Intergenic
1161582335 19:5087639-5087661 GCATCTCCCCTCTCCTGCTGAGG + Intronic
1165827564 19:38713986-38714008 GCCTGTCCACTCTCCTGCCTTGG - Intronic
928359829 2:30654208-30654230 GCTTTTCCACACACCTGCTTGGG + Intergenic
930363279 2:50408753-50408775 GCATTTCTACTCTTCAGCTGTGG - Intronic
931749908 2:65321199-65321221 GCGTTTAATGTCTCCTGCTGTGG + Intronic
932014099 2:68006950-68006972 ACTTTTCCACTCTCCCGCTGAGG - Intergenic
933298755 2:80519921-80519943 GCGTGACCAGTCTCCTGATGTGG - Intronic
934300767 2:91774889-91774911 GACTTGCCACTCACCTGCTGTGG - Intergenic
935395125 2:102599617-102599639 ACGGTTTCACTCTCCTCCTGGGG + Intergenic
936343325 2:111656695-111656717 GGCTCTCCACTCCCCTGCTGGGG + Intergenic
937052600 2:118904798-118904820 GTGCTTCCATTCTCCTGCTGAGG + Intergenic
937218038 2:120325029-120325051 GGATTGCCACTCACCTGCTGGGG + Intergenic
937262560 2:120595823-120595845 GAGTTCCCAGCCTCCTGCTGTGG - Intergenic
937456083 2:122042852-122042874 CCAATTCCACTGTCCTGCTGGGG - Intergenic
937462195 2:122099138-122099160 TCTTCTCCACTCCCCTGCTGAGG + Intergenic
939441182 2:142252118-142252140 TGGTTTCCATTCTCTTGCTGAGG - Intergenic
940111468 2:150159576-150159598 GCGTTTCTAGTCTGCAGCTGTGG + Intergenic
943556034 2:189404891-189404913 GTTTATCCACTCTCCTGTTGAGG + Intergenic
947040434 2:225912185-225912207 CCATTCCCACTCACCTGCTGGGG + Intergenic
1172186816 20:33036044-33036066 AGGTTTCCTCTCTCCTGCTTTGG - Intronic
1172615898 20:36284138-36284160 GGTTTTCCATTCTCCTGATGAGG + Intergenic
1174753907 20:53139471-53139493 GCGTTTACTCTGCCCTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1176122646 20:63461091-63461113 GCTTTCCCAGTCTCCTGCGGTGG + Intronic
1180816394 22:18792248-18792270 GACTTGCCACTCACCTGCTGTGG + Intergenic
1181202581 22:21226580-21226602 GACTTGCCACTCACCTGCTGTGG + Exonic
1181699122 22:24610025-24610047 GACTTGCCACTCACCTGCTGTGG - Exonic
1184040955 22:41943240-41943262 GTGAGTCCACTCTCCTGCTGGGG - Intronic
1203224332 22_KI270731v1_random:68833-68855 GACTTGCCACTCACCTGCTGTGG - Intergenic
1203266494 22_KI270734v1_random:17959-17981 GACTTGCCACTCACCTGCTGTGG + Intergenic
950115238 3:10446551-10446573 GCTTTGCCACTTGCCTGCTGTGG - Intronic
950373393 3:12550198-12550220 GTTTTTCCATTCGCCTGCTGAGG - Intronic
952385798 3:32840789-32840811 GCCTTGCGACTCTGCTGCTGGGG + Intronic
952791903 3:37206647-37206669 CCATTTCCACTTTCCTGCGGGGG + Intergenic
954422824 3:50427519-50427541 ACCCTTCCACTCTCCTGCTCTGG - Intronic
954796328 3:53162987-53163009 GGGTTTCCTCGTTCCTGCTGTGG + Intronic
954841544 3:53515944-53515966 GAGTCTCCACTCTCCTGATACGG - Intronic
956636118 3:71367227-71367249 GCGCCTCCTCTCTCCTGCAGAGG + Intronic
960382626 3:116982947-116982969 GTTTATCCAGTCTCCTGCTGTGG - Intronic
962187970 3:133280114-133280136 GTGTTTCTTCTCCCCTGCTGAGG + Intronic
963117019 3:141738666-141738688 GCGGAGCCACGCTCCTGCTGCGG + Intronic
967994031 3:195153324-195153346 ACGTTTGCAGTCTCATGCTGGGG - Intronic
968734986 4:2290674-2290696 GCCTCACCCCTCTCCTGCTGTGG + Intronic
971811054 4:31427769-31427791 TCTTTTCCTCTCTCCTTCTGAGG - Intergenic
974755759 4:66205125-66205147 GCGTTTAGACTGCCCTGCTGGGG + Intergenic
978515338 4:109562197-109562219 GGGTATCCACATTCCTGCTGAGG - Intronic
978769806 4:112443149-112443171 CCCATTCCAATCTCCTGCTGTGG + Intergenic
981110875 4:140931962-140931984 GCCTTTTCTCTCTCCAGCTGGGG - Intronic
985016723 4:185643653-185643675 GGTTTTCCCCTCTCCTGCAGTGG - Intronic
985532618 5:443027-443049 GCGGTTTCCCTGTCCTGCTGGGG + Exonic
986429507 5:7667181-7667203 GCTTTTCCACTTTCCTGATGAGG + Intronic
986728698 5:10619047-10619069 GCATTGCGACTCTCCTGCTTTGG + Intronic
990855925 5:60266270-60266292 GGCTTTCCAATATCCTGCTGTGG - Intronic
996103632 5:119472457-119472479 GAGTTTCCACTCTGCTGCCCAGG + Intronic
1002662175 5:180798729-180798751 GTCTTTTCTCTCTCCTGCTGTGG + Intronic
1004138054 6:12987964-12987986 CCACTTACACTCTCCTGCTGGGG + Intronic
1006259777 6:32858167-32858189 GCTTCCCCACTCTCCTGCAGAGG + Intronic
1006912170 6:37570530-37570552 GCGTTTCCTCCCGTCTGCTGGGG + Intergenic
1013600765 6:111702805-111702827 CCCTTTCCACTTTCCTGCTCTGG + Intronic
1016667356 6:146657596-146657618 GCCTCTGCACTCTCATGCTGAGG + Intronic
1023234466 7:38069243-38069265 GTTTATCCAGTCTCCTGCTGAGG - Intergenic
1026956592 7:74380169-74380191 GAGTTTCCAGTCTCCTGCCCAGG - Intronic
1029105827 7:98174905-98174927 GCGTTTCCACTCTCCTGCTGGGG - Intronic
1029379159 7:100201343-100201365 GCCTGTCCACTCACCTGGTGAGG - Exonic
1031483289 7:122302931-122302953 GCTTTTCCTTTCTCCTGCTTAGG - Exonic
1032591955 7:133199943-133199965 GAGTTGTCTCTCTCCTGCTGTGG - Intergenic
1033429081 7:141272196-141272218 GCATTTCCCATCTCCTGCAGTGG + Intronic
1034329091 7:150267557-150267579 GCATCACCACTCTCGTGCTGTGG - Intronic
1035125532 7:156605848-156605870 GGGTCCCCACTCTCCTGCTTGGG - Intergenic
1036717870 8:11143716-11143738 GAGTTTCTAATTTCCTGCTGTGG + Intronic
1037602415 8:20408497-20408519 GCATTTCCACCTTACTGCTGAGG - Intergenic
1041321443 8:56618275-56618297 GCGTTTCACCTCTGCTTCTGTGG + Intergenic
1041854720 8:62438494-62438516 GTGTTACCTCTCTCCTGCTCTGG + Intronic
1045772661 8:105761854-105761876 GAGTTTCTACTCTATTGCTGGGG - Intronic
1047243262 8:123114344-123114366 GAGTTTCCACTCTGCTGCCCAGG + Intronic
1047292218 8:123540885-123540907 GCGGGTCCCCTCACCTGCTGAGG + Exonic
1047739246 8:127794083-127794105 GTCTTCCCACTTTCCTGCTGAGG - Intergenic
1048863095 8:138738212-138738234 GCGTTTCTGCTCTTCTGCTGTGG + Intronic
1051436083 9:17033713-17033735 TCCTTCCCACTCTCCTTCTGAGG - Intergenic
1052976530 9:34414853-34414875 GAGTGTCCACTCTCCAGCTCTGG + Intronic
1053448848 9:38175974-38175996 GTGCTTCCTCTCTCTTGCTGGGG - Intergenic
1055428504 9:76219695-76219717 CGGCTTCCCCTCTCCTGCTGCGG + Intronic
1059908921 9:119021016-119021038 GCCTGTCGACTCTCCTTCTGTGG + Intergenic
1060940248 9:127539330-127539352 GGTTTTCCACTCTCTTGCTGGGG + Intronic
1061625803 9:131840073-131840095 GTGTGTCCAGTGTCCTGCTGGGG + Intergenic
1062218598 9:135402515-135402537 GCCTTGCCAGTCTCCTCCTGTGG + Intergenic
1185867984 X:3639691-3639713 CGGGTTCCACTCTCCTCCTGCGG + Intronic
1189984460 X:46541900-46541922 GTTTTTCCTCTCTCCTGGTGAGG + Intronic
1190216555 X:48482722-48482744 ACGTGTCCACTCTGCTGATGGGG - Exonic