ID: 1029106036

View in Genome Browser
Species Human (GRCh38)
Location 7:98176897-98176919
Sequence CAGCACTACCACTTAAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029106036_1029106043 23 Left 1029106036 7:98176897-98176919 CCAACTCTTAAGTGGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1029106043 7:98176943-98176965 CAGGAGACGCAGGCACAGACAGG No data
1029106036_1029106039 4 Left 1029106036 7:98176897-98176919 CCAACTCTTAAGTGGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1029106039 7:98176924-98176946 TCCCGTCTGTGTTACAGGTCAGG No data
1029106036_1029106042 13 Left 1029106036 7:98176897-98176919 CCAACTCTTAAGTGGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1029106042 7:98176933-98176955 TGTTACAGGTCAGGAGACGCAGG 0: 1
1: 0
2: 0
3: 23
4: 229
1029106036_1029106038 -1 Left 1029106036 7:98176897-98176919 CCAACTCTTAAGTGGTAGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1029106038 7:98176919-98176941 GGTTTTCCCGTCTGTGTTACAGG 0: 1
1: 0
2: 1
3: 7
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029106036 Original CRISPR CAGCACTACCACTTAAGAGT TGG (reversed) Intronic
900103404 1:972220-972242 CAGCGCCCCCACTAAAGAGTCGG - Intronic
906087150 1:43145560-43145582 CAGCACTTCTACTTCAGAATGGG + Intronic
906376664 1:45301995-45302017 CAGCACCAACATTTCAGAGTGGG + Intronic
909925411 1:81432303-81432325 CAGCCCTACTGCTGAAGAGTTGG + Intronic
910923174 1:92371353-92371375 CAGCAATCCCACTGAAGGGTGGG + Intronic
912604211 1:110971859-110971881 CATAACTCCCACTTAAAAGTGGG - Intergenic
914394964 1:147257084-147257106 CAGCAATACCACCTAATAATGGG + Intronic
916491038 1:165302684-165302706 CAGCACTACCACTGAATTTTTGG + Intronic
922495495 1:226054223-226054245 CAGCACTGCCACTTATTACTAGG - Intergenic
922557865 1:226546797-226546819 CAGCTCTACCACTGATTAGTGGG + Intergenic
923152150 1:231242879-231242901 GAGAACTACCAGTAAAGAGTGGG - Intronic
1074488977 10:113921722-113921744 CTGAACTGCCACTGAAGAGTGGG + Intergenic
1074790417 10:116881052-116881074 CTCCACTCCCACTTTAGAGTAGG + Intronic
1080753583 11:35173939-35173961 CTGCTCTGCCACTTAAGAGCTGG + Intronic
1086161345 11:83725323-83725345 CCAGACTACCACTTCAGAGTTGG - Intronic
1086978495 11:93165944-93165966 CAGCAGTACCAAAAAAGAGTGGG + Exonic
1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG + Intergenic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1095415041 12:41967433-41967455 TGTCACTACCACTGAAGAGTAGG - Intergenic
1103587995 12:121970455-121970477 TAGCAGTCCCATTTAAGAGTTGG - Intronic
1107051205 13:36052052-36052074 CATCACTATCACTTTAGAGATGG + Intronic
1110008048 13:70297097-70297119 GAGCACTACCCCTTCTGAGTTGG + Intergenic
1111997258 13:95176998-95177020 CAGAAACACCACGTAAGAGTTGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112797501 13:103072201-103072223 CAACACTAACACTTAACAATTGG - Intergenic
1113295043 13:108950317-108950339 CAGCACTCCAAATTAACAGTAGG + Intronic
1116555121 14:46293192-46293214 AAGCACTAACACTGAAGAATCGG - Intergenic
1117501122 14:56352373-56352395 CAGCTCCACCACTAAATAGTTGG - Intergenic
1118893671 14:69928900-69928922 CATCAACACCACCTAAGAGTTGG - Intronic
1120384673 14:83829094-83829116 CAGCCCTAGCACTTAAGATCTGG - Intergenic
1120614784 14:86690001-86690023 CAGAACTACCTGTTAAAAGTAGG - Intergenic
1124231320 15:27948351-27948373 CAGCAGTGCCACTCAAGAGAAGG + Intronic
1127217608 15:56840564-56840586 CAACATGACCACTTAAGAGGAGG + Intronic
1129743810 15:78004010-78004032 CAGCTCTACCACTTACTAGCTGG + Intronic
1130526207 15:84708844-84708866 CTGCAATAACAGTTAAGAGTTGG + Intronic
1135242003 16:20815707-20815729 CAGCCCTACCACTTACTAGCTGG - Intronic
1137920118 16:52478695-52478717 CAGCTCTACCACTTACAAGCTGG + Intronic
1141275080 16:82580061-82580083 CAGTTCTGCCACTTATGAGTTGG + Intergenic
1143931256 17:10428945-10428967 GAGCACCACCACTTAACAGGTGG - Intergenic
1144487995 17:15683660-15683682 CACAACCACCACTTAATAGTAGG + Intronic
1144578697 17:16445838-16445860 CAGCCCCACCACTTACCAGTTGG + Intronic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1147263826 17:39223662-39223684 CAGCACTCCCACATAGGAGGAGG + Intronic
1147991428 17:44336041-44336063 CAGCCCTACCACTCATGAGTTGG + Intergenic
1149019388 17:51945586-51945608 CAGTTCTACCACTTAACAGGGGG + Intronic
1203162991 17_GL000205v2_random:68795-68817 CAGCCCTACCACTGAAAAGGAGG + Intergenic
1158442705 18:57491232-57491254 CAGCACTACCATTTAATGATAGG - Exonic
1160421230 18:78746904-78746926 GAGCAATATCACTTAAAAGTGGG - Intergenic
1166041009 19:40202934-40202956 CAGCACTGTCACTGAAGAATGGG + Intronic
929557951 2:42937175-42937197 CAGCCCTGCCACTTAAGAACCGG - Intergenic
931094080 2:58919918-58919940 CAGCACTTACACTTTAGGGTGGG + Intergenic
938641881 2:133289736-133289758 CAGCACAACTACTTGAGACTGGG + Intronic
938927158 2:136054678-136054700 CAGCTCTACCACTTACTAGCTGG - Intergenic
943329845 2:186545955-186545977 CAGCTCTACCACTTTCTAGTTGG - Intergenic
943592644 2:189817411-189817433 CACCACTACCACATAAAATTAGG - Intronic
1171095059 20:22325003-22325025 CATCACTATTACTTAGGAGTGGG - Intergenic
1173760427 20:45554866-45554888 CATCACTACCACTTTACAGATGG - Intronic
1176338845 21:5624054-5624076 CAGCCCTACCACTGAAAAGGAGG - Intergenic
1176340253 21:5687127-5687149 CAGCCCTACCACTGAAAAGGAGG - Intergenic
1176472507 21:7119280-7119302 CAGCCCTACCACTGAAAAGGAGG - Intergenic
1176504574 21:7637329-7637351 CAGCCCTACCACTGAAAAGGAGG + Intergenic
1177560584 21:22745939-22745961 CTGCACCAACACTTAGGAGTTGG - Intergenic
1183069673 22:35387293-35387315 CAGCACTGCCACTTACTAGCTGG + Intronic
1183208755 22:36436936-36436958 CAGCACTACCACTTCCTGGTTGG + Intergenic
1183719972 22:39557156-39557178 CAGCTCTACCGTTTAAGAGCTGG + Intergenic
1203239517 22_KI270733v1_random:1585-1607 CAGCCCTACCACTGAAAAGGAGG - Intergenic
958816371 3:98920771-98920793 GAGCACTACCATTTAAAAGAAGG + Intergenic
959137608 3:102443876-102443898 AAGCACTACCACTAAAAAGTAGG - Intronic
961241067 3:125412074-125412096 CAGCACTAACATTTAAGGGATGG + Intergenic
961267000 3:125651446-125651468 CAGCCCTTCCACTTAGTAGTTGG - Intergenic
963333733 3:143947317-143947339 CAGCCCTAACACTTAAGGTTAGG + Intergenic
965686497 3:171308716-171308738 AAACACCACCACTTAAAAGTGGG + Intronic
966569306 3:181423376-181423398 CAGCTCTACCACTTACTAGCTGG + Intergenic
969110769 4:4842833-4842855 CAGCGCTACCACTTATGAGCTGG + Intergenic
970356388 4:15257525-15257547 CAGCTCAGCCACTTAACAGTGGG + Intergenic
971013308 4:22462774-22462796 GAGCACTACCACTTGGGGGTGGG + Intronic
972096874 4:35358801-35358823 CTGCTCTACCTCTTATGAGTTGG + Intergenic
978427663 4:108598750-108598772 CAGCTCTGCCACTTAACAGAGGG + Intergenic
978912983 4:114087148-114087170 CTGCACTATCACTTTAGTGTCGG + Intergenic
980203021 4:129679748-129679770 CAGTTCTGCCACTTAAAAGTTGG - Intergenic
983058868 4:163131878-163131900 CAGCAATACAATTTAAAAGTTGG + Intronic
992344680 5:75864940-75864962 CAACCCTACCACTGAAGTGTTGG + Intergenic
992959876 5:81947630-81947652 CAACCCTACCTCTTAATAGTAGG + Intergenic
1000766405 5:165296339-165296361 CTGCTCTGCCACTTAAGAGTCGG - Intergenic
1005021229 6:21420967-21420989 CACCAGAACCTCTTAAGAGTAGG - Intergenic
1007452008 6:41947290-41947312 CAGCACTACCAAATCAGAGTTGG + Intronic
1007462513 6:42028677-42028699 CAGCTCTAGCACTTAGGAGCGGG + Intronic
1009816690 6:68746086-68746108 CAGCACTAACATTTAAAAATGGG - Intronic
1010259970 6:73804522-73804544 CAACACCACCACCTAAGAGCGGG - Intronic
1010762141 6:79735518-79735540 CAGAACTACCACGTGAGTGTTGG - Intergenic
1011829323 6:91352061-91352083 CAGCCCTCCCCCTTAGGAGTTGG - Intergenic
1015229450 6:130897530-130897552 CAGCATTGCCATTTAAGAATTGG + Intronic
1017389111 6:153919211-153919233 CAATACAACCAATTAAGAGTTGG + Intergenic
1018226184 6:161630994-161631016 CAGCACTACCCCAGAAGGGTGGG + Intronic
1019263201 7:93927-93949 CAGCTCAGCCACTTAAAAGTAGG + Intergenic
1021209218 7:17824653-17824675 CAGCTCTGCCAGTTAATAGTTGG - Intronic
1024097098 7:45990923-45990945 CAGCTCTACCACTTTGGAGAGGG + Intergenic
1028038103 7:86011478-86011500 AAGCAATACCAGTTAACAGTAGG + Intergenic
1028233604 7:88333623-88333645 CTGCACTTCCACTTAAGCCTAGG - Intergenic
1029106036 7:98176897-98176919 CAGCACTACCACTTAAGAGTTGG - Intronic
1031083301 7:117278648-117278670 CAGCTCTCCCACTTCTGAGTTGG + Intronic
1031315542 7:120254020-120254042 CAACACTAACACTTATGGGTGGG - Intergenic
1038047396 8:23777253-23777275 CAGCTCTGCCACTCATGAGTGGG + Intergenic
1043720148 8:83538018-83538040 CTGAAATACAACTTAAGAGTCGG - Intergenic
1046767886 8:118090192-118090214 CAGGAATACCACTTAAGACCAGG + Intronic
1051139504 9:13963475-13963497 CTGCACTCCCACTTCTGAGTGGG - Intergenic
1052365677 9:27609494-27609516 CAGCCGTGCCACTGAAGAGTTGG - Intergenic
1053295079 9:36906928-36906950 CAGCTCTGCCACTTATGAATTGG - Intronic
1056333951 9:85547267-85547289 CAGCCCTACCACTTATGTCTTGG - Exonic
1057411768 9:94822885-94822907 CGGCACTATCACTTAGGAGACGG - Intronic
1057602913 9:96473906-96473928 CAGCTCTGCCACTTACTAGTTGG + Intronic
1058645700 9:107129897-107129919 CGGCTCTGCCACTTAATAGTTGG - Intergenic
1203422814 Un_GL000195v1:10866-10888 CAGCCCTACCACTGAAAAGGAGG + Intergenic
1186339571 X:8629632-8629654 CAGTACTTCCACTCATGAGTTGG - Intronic
1196889410 X:120277660-120277682 CAGTTCTACCACTTACGACTTGG - Intronic
1198238037 X:134755277-134755299 AAGAGCTACCACTTAATAGTTGG - Intronic
1199661181 X:150052603-150052625 CAACTCTAGGACTTAAGAGTGGG + Intergenic