ID: 1029106238

View in Genome Browser
Species Human (GRCh38)
Location 7:98178899-98178921
Sequence GTGACCAGCCCAGCATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029106237_1029106238 -9 Left 1029106237 7:98178885-98178907 CCTCTGCTATGCATGTGACCAGC 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG 0: 1
1: 0
2: 3
3: 30
4: 257
1029106235_1029106238 19 Left 1029106235 7:98178857-98178879 CCTGTTGTTTCGTGAGGAAACTG 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG 0: 1
1: 0
2: 3
3: 30
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029106238 Original CRISPR GTGACCAGCCCAGCATCACA TGG Intronic
900087115 1:904037-904059 GTGCCCAGCCCAGCATCCCGGGG + Intergenic
900325290 1:2105813-2105835 GTGACCTTCCCGGCATCACCTGG - Intronic
900942648 1:5810948-5810970 GTGACCTGCCCAGAGCCACAGGG - Intergenic
901219546 1:7575557-7575579 GTGACTAGCCCAAAGTCACATGG - Intronic
901867792 1:12118682-12118704 GTGATCAGCCCATCATCTCTAGG + Intronic
902188610 1:14744352-14744374 GTGGCCTGTCCAGAATCACATGG + Intronic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903827018 1:26153720-26153742 GAGACCAGCCTGGCAACACAGGG - Intergenic
904206150 1:28856595-28856617 GTCACCACCACAGCAACACACGG - Intronic
904274104 1:29369295-29369317 GGAACCTGCCCCGCATCACACGG + Intergenic
904442107 1:30538807-30538829 GTGTCCAGCTCAGCATGAAAGGG - Intergenic
904602727 1:31682830-31682852 CTGCCCATCCCAGCAGCACAGGG - Intronic
905022746 1:34828909-34828931 GTAACCAGCCCAGAGTCACATGG - Intronic
906265495 1:44425625-44425647 GAGACTTACCCAGCATCACACGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906578258 1:46910619-46910641 CTCACCTGCCCTGCATCACAAGG - Intergenic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
912708706 1:111934113-111934135 GTGACCTACCCAGAACCACACGG - Intronic
912748524 1:112266290-112266312 TTGTCCAGCCCAGCACCTCAAGG + Intergenic
913117414 1:115710343-115710365 ATGACTTGCCCAGCATCACACGG + Intronic
913211921 1:116589338-116589360 CTGCACAGCCCACCATCACAGGG + Intronic
913380561 1:118205779-118205801 GTGGCCATCTCAACATCACAGGG + Intergenic
915507277 1:156365967-156365989 GTGACCAGCTGAGCAACAGAAGG - Intronic
915784384 1:158593235-158593257 TTGCCCAGGCCAGTATCACAAGG - Intergenic
916591579 1:166195856-166195878 GTGACTTGCCCACAATCACATGG - Intergenic
918084968 1:181237537-181237559 GTGACCAGCACAGCAGCCCTTGG + Intergenic
919147507 1:193654714-193654736 GAGACAATCCCATCATCACAAGG - Intergenic
920120678 1:203654688-203654710 GAGACCAGCCTGGCAACACAGGG + Intronic
920447310 1:206028464-206028486 GTGATCAGCCCAAGAGCACATGG + Intergenic
921182439 1:212642217-212642239 GAGACCAGCCCAGCATTTAAAGG - Intergenic
921256021 1:213340202-213340224 GAGAGAAGCCCAGCATCACAGGG - Intergenic
922042181 1:221907242-221907264 GTTCTCAGCCCAGCATCACCGGG + Intergenic
923221409 1:231897650-231897672 GTGACCAGCTCAAAATCAGATGG - Intronic
1063555989 10:7080427-7080449 GTCAGCAAACCAGCATCACAAGG + Intergenic
1065378282 10:25064414-25064436 GAGACCAGCCTAGCAACACAGGG - Intergenic
1067222998 10:44357329-44357351 CTGACCAGCCCAGCACAACAAGG + Intergenic
1070442301 10:76458706-76458728 GTGGGAAGCCCAGCTTCACAGGG + Intronic
1070828660 10:79405642-79405664 GTGACCAGCCCAGCCTTCCCTGG + Intronic
1073337447 10:102720407-102720429 GAGACCAGCCTAGCAACATAGGG + Intronic
1074817263 10:117151786-117151808 GTGACCAGGCCAGCCTCATGGGG - Intergenic
1074825965 10:117216140-117216162 GTCAACTGCCCAGCATCACTTGG + Intergenic
1075006452 10:118833899-118833921 GTCACCAGGCCAGCTTCACCTGG + Intergenic
1075683703 10:124349733-124349755 CTGACAAGCCCAGGAACACAGGG - Intergenic
1076414779 10:130277853-130277875 GTGACAAACCCACAATCACAGGG - Intergenic
1076508719 10:130997416-130997438 GGGACCAACCCAGCCTCCCAGGG + Intergenic
1076666737 10:132097418-132097440 GTGGCCCTCCAAGCATCACACGG + Intergenic
1076820990 10:132939497-132939519 GTGGCCGGCCCAGGACCACAAGG - Intronic
1079605536 11:22360900-22360922 GTGACCTACCCAGCATGTCATGG + Exonic
1081852218 11:46281604-46281626 GGGACCAGCCCAGCATTGCGGGG + Intronic
1082303858 11:50546725-50546747 TTAACCAGCCTTGCATCACAGGG - Intergenic
1086916566 11:92536430-92536452 GTCACTTGCCCAACATCACATGG - Intronic
1089679754 11:120112629-120112651 GGGACCAGCCCCTGATCACAGGG - Intronic
1089755135 11:120680966-120680988 GTGCTTGGCCCAGCATCACAGGG + Intronic
1091340089 11:134804551-134804573 CTGCCCAGCCCTGTATCACAGGG + Intergenic
1091950703 12:4590819-4590841 GTGACTTGCCCAGGAGCACATGG - Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1096067821 12:48755105-48755127 GTGACCACCCCCGAGTCACAGGG + Intergenic
1096123338 12:49102725-49102747 GTGACCAGCTCTGCATGATAGGG + Intronic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1097568228 12:61297576-61297598 TTGACCAGCCTTGCATCCCAGGG - Intergenic
1099953775 12:89332630-89332652 GTAACTAGCTCAGCATCACAGGG + Intergenic
1100764112 12:97844474-97844496 GTGACTTGCCCAGTATCACTTGG - Intergenic
1101649404 12:106661131-106661153 AGGACCTGCCCATCATCACATGG - Intronic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1104935727 12:132363425-132363447 CTGCCCAGCCCTCCATCACAAGG - Intergenic
1105215172 13:18279964-18279986 CTGCACAGCCCACCATCACAGGG + Intergenic
1109416018 13:62042043-62042065 GAGACCAGCCAAGCAACATAAGG - Intergenic
1112762704 13:102709252-102709274 GTGACTAGCACAGCACCACAGGG + Intergenic
1115305518 14:31929945-31929967 GAGACCAGCTCTGCATAACAGGG + Intergenic
1115615253 14:35088785-35088807 GTGAACAGCCCAGGATTATAGGG + Intronic
1116163869 14:41308570-41308592 ATGAATAGCCAAGCATCACATGG + Intergenic
1117465022 14:55984559-55984581 GTGGCCAGCCCAGCGGCACATGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121783870 14:96640096-96640118 GTCACCAGCACAGGACCACAGGG - Intergenic
1122092067 14:99347408-99347430 GGGACCAGTCCAGCTTCATAGGG - Intergenic
1122619289 14:103045413-103045435 GTGAACAGCCCCACATCACGTGG + Intronic
1202902472 14_GL000194v1_random:51589-51611 GTGCCCACCCCAGCCTCAGAAGG - Intergenic
1123996153 15:25719337-25719359 GTCACCTGCCCACCATCACAAGG + Intronic
1126526754 15:49664838-49664860 GTGGCCAGCCCAGCAGCTGATGG + Intergenic
1126950982 15:53881009-53881031 TTGACAAGGCCAGCATCACTTGG - Intergenic
1127122674 15:55785216-55785238 GTACCCAGCCCAGGATAACAGGG - Intergenic
1128260227 15:66228030-66228052 GTGACCTGCCCATAGTCACAAGG - Intronic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1132609549 16:808441-808463 GTTACCTGCCCAACAACACAGGG + Intronic
1133173258 16:3994865-3994887 GAGACTAGCTCACCATCACACGG - Intronic
1133331909 16:4980067-4980089 GTGACTCGCCCAGCAGCACATGG - Intronic
1133724338 16:8523401-8523423 CTCACCTGCCCTGCATCACAAGG - Intergenic
1138603299 16:58070759-58070781 GTGACCAGCCTTGCATCTGAGGG - Intergenic
1138772884 16:59686450-59686472 GTCACAGGCCCAACATCACATGG + Intergenic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139407520 16:66730808-66730830 CTGGCCAGCTCAACATCACAGGG + Intronic
1139571932 16:67818313-67818335 GAGACCAGCCTGGCAACACAGGG + Intronic
1140035251 16:71366896-71366918 TTGACTTGCCCAACATCACATGG + Intronic
1140110471 16:71999890-71999912 CTAAACAGCCCAGCACCACATGG - Exonic
1141687482 16:85578585-85578607 CTGACTTGCCCAGCATCCCAGGG + Intergenic
1142393724 16:89819122-89819144 GTGACCAGTGAAGCACCACAGGG - Intronic
1143736809 17:8916746-8916768 CTGACCAGCCCTGCACCAGAGGG - Intronic
1144438865 17:15263409-15263431 GTGGCCCGCCCAGCGTTACAGGG + Intronic
1144482586 17:15639912-15639934 GTGACCAGGCTAGCAGCAGAGGG - Intronic
1144829164 17:18122003-18122025 GTGACCAGACCAGGGCCACATGG + Exonic
1145010785 17:19366489-19366511 GTGAGGAGCCCAGAATCACAGGG - Intronic
1146674681 17:34765130-34765152 GTGACTGGCCCAGGGTCACATGG + Intergenic
1147925255 17:43941854-43941876 GTGAGCAGCCCAGCAAGCCAGGG + Intronic
1148371431 17:47102607-47102629 GTGACCAGAGCAGCAGCTCAGGG - Intergenic
1148383066 17:47214098-47214120 GTGACTTGCCCAGTCTCACATGG + Intronic
1150132178 17:62675188-62675210 GTTAACAGCCCAGGATCACCAGG + Intronic
1151235219 17:72715062-72715084 GCGACCAGTGCAGCATCCCAGGG + Intronic
1151724232 17:75875336-75875358 GGGACCAGCCCAGCAGCCCTGGG + Intronic
1152713470 17:81886659-81886681 GTCACCAACCCAGCATCAGGGGG + Intergenic
1153373473 18:4348353-4348375 GATTCCAGTCCAGCATCACAGGG - Intronic
1154327042 18:13398793-13398815 GTGACCAGCCCACCCTCCCCGGG + Intronic
1157501625 18:48194650-48194672 GGGACAGGCCCAGCATCACCAGG + Intronic
1157797494 18:50588510-50588532 AAGACCAGCCCAGATTCACAGGG + Intronic
1157894239 18:51448832-51448854 TTGATCTGCCCAGCTTCACAAGG + Intergenic
1158098996 18:53808006-53808028 TTGACCAGCCTTGCATCCCAAGG - Intergenic
1158733960 18:60058257-60058279 GAGACCAGCCTAGCAACACAGGG + Intergenic
1159947260 18:74453796-74453818 GTGACTTGCCCTGCTTCACACGG - Intronic
1160297774 18:77653984-77654006 GTGACGTGCCCAGGTTCACAGGG + Intergenic
1160512564 18:79460814-79460836 GTTCCCAGCCCAGCCTCCCAGGG - Intronic
1160544712 18:79645281-79645303 GTGACGAGCCTAGGGTCACACGG - Intergenic
1161165303 19:2783550-2783572 GTGGCCGGCCCAGCACCACGTGG - Intergenic
1163726455 19:18925821-18925843 GTGACCTGCCCAGCACCACAGGG - Intronic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1167117862 19:47498492-47498514 CTGACTTGCCCAGGATCACAGGG + Intronic
1168061172 19:53893102-53893124 GAGCCCAGCCCAGCCTCCCACGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925975607 2:9139987-9140009 GTGACGTCCCCAGGATCACAGGG + Intergenic
926323831 2:11767342-11767364 GTAACCAGCCCAGGGTCACATGG - Intronic
926396957 2:12453417-12453439 GTGACATGCACAGCTTCACATGG - Intergenic
926621996 2:15055092-15055114 GTATCCAGTCCAACATCACATGG - Intergenic
926739874 2:16102354-16102376 GTGACCAGGCCCTCACCACAGGG + Intergenic
927355917 2:22173082-22173104 TTTACCAGACCAGCATTACACGG - Intergenic
927461986 2:23307168-23307190 GTGAGGAGCCCAGGATCTCAGGG - Intergenic
927872217 2:26630874-26630896 GTGCACAGCCCAGGAGCACAGGG - Intronic
929061275 2:37926735-37926757 GGGACCAGCCTAGCAACATAGGG + Intronic
929279185 2:40059747-40059769 GTGTCCAGACCAGCAGCACCTGG + Intergenic
929659932 2:43774074-43774096 GTGACCAGCCTAGAATCAGGCGG - Exonic
930314876 2:49785481-49785503 CTGACCAGCCCACCACCACTGGG - Intergenic
930711419 2:54554367-54554389 GTGACCATACCTGCCTCACAGGG + Intronic
930769082 2:55113788-55113810 CTGACCAGCCCAGAATCAGAAGG + Intergenic
931827971 2:66021012-66021034 GTAACAAGCCCAGGGTCACATGG - Intergenic
932184820 2:69685280-69685302 GTTACCAGCCCAGTACCTCAGGG + Intronic
932840882 2:75081341-75081363 ATGACCAGCCCACCACCATATGG + Intronic
932879975 2:75492182-75492204 GTGAAAAGCCCATTATCACACGG + Intronic
934299148 2:91766773-91766795 CTGCACAGCCCACCATCACAGGG - Intergenic
934504198 2:94878811-94878833 GTGCCCACCCCAGCCTCAGAGGG + Intergenic
935133478 2:100278700-100278722 TTGCCCAGCCCAGCAGCTCACGG + Exonic
936758878 2:115749477-115749499 GTGTCAAGCCCAGAGTCACAGGG - Intronic
937081875 2:119146119-119146141 GTGACCAGTCCAGGGTCTCATGG - Intergenic
937442569 2:121929482-121929504 GTGACCTGCCCATTATCATATGG + Intergenic
942403805 2:175631266-175631288 ATGACCACCCCAGCATCTCAGGG + Intergenic
945419940 2:209622408-209622430 GTGTCCTTCCCAGCATCACAAGG - Intronic
946342847 2:219082739-219082761 CTGACCATCACAACATCACAAGG + Intronic
948356927 2:237385515-237385537 ATGACCTGCCCAGGATCACATGG + Intronic
948979206 2:241484362-241484384 GGGCCCAGCCCAGCACCACGTGG - Intronic
1168827549 20:823655-823677 GTGACCTGGCCTGGATCACACGG - Intergenic
1168961727 20:1874630-1874652 GTGACTTGCCCAGCATCACATGG - Intergenic
1170387890 20:15840307-15840329 CTGACCAGCTCACCATAACATGG - Intronic
1173235652 20:41243246-41243268 GCTACCAGCCCAGCATCAGTAGG + Intronic
1173753635 20:45496226-45496248 GGGACCACCCCAGCAGAACATGG + Intergenic
1174428314 20:50448976-50448998 GTGACCAACCCAGCAGAGCAAGG - Intergenic
1174546686 20:51331116-51331138 GTGACCAGCATCTCATCACAGGG - Intergenic
1175329830 20:58155916-58155938 GTGAGCAGCCTATCAGCACAGGG - Intronic
1175893441 20:62325380-62325402 GTGGCCAGCCCAGCAGGCCAGGG - Exonic
1176168355 20:63686083-63686105 GTGACCTGCCCAGAGTCACCTGG + Intronic
1176296002 21:5073553-5073575 GTCACCTCCCCAGCACCACAAGG + Intergenic
1176621838 21:9066356-9066378 GTGCCCACCCCAGCCTCAGAAGG - Intergenic
1179580357 21:42339499-42339521 GTTAACTGCCCAGCATCCCATGG + Intergenic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1179861047 21:44188568-44188590 GTCACCTCCCCAGCACCACAAGG - Intergenic
1181582100 22:23834177-23834199 GTAACCAGCCCATCAGCACACGG + Exonic
1181754811 22:25016309-25016331 GTGCCCAGCCAAGAATCACAGGG + Intronic
1181983031 22:26779749-26779771 GAGACCATCCCAGCATCAAGGGG - Intergenic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182112032 22:27730878-27730900 GTGGCCAGGCCAGTGTCACATGG - Intergenic
1182348123 22:29681275-29681297 GTGACCAGCCCAAGCTCCCATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1184996899 22:48213910-48213932 GAGAGCTGCCCATCATCACAGGG - Intergenic
1185171914 22:49299229-49299251 GTGCCCAGCACAGCTTCTCAGGG + Intergenic
1185386546 22:50534351-50534373 GTGACCAGTGAAGCACCACAGGG - Intergenic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949879249 3:8648881-8648903 GTGACCAGGCCACCATTAGACGG - Intronic
950145322 3:10645834-10645856 GTGACCAGGAAAGCATCAAAGGG + Intronic
950172358 3:10847793-10847815 GAGACGAGCCCAGCATCCAAAGG + Intronic
950419578 3:12890813-12890835 ATGCCCAGCCCAGCGTCAGAGGG - Intergenic
953417003 3:42728273-42728295 GTGCTCATCCCAGCATCCCAGGG - Intronic
953709775 3:45260221-45260243 GGGAGCAGCACATCATCACATGG - Intergenic
954867820 3:53744601-53744623 GAGATCAGCTCAGCACCACATGG + Intronic
957721760 3:84011421-84011443 GGAACCAGCCCTGCATCCCAGGG - Intergenic
960044430 3:113183068-113183090 GAGACTATCCCAGCAGCACATGG + Intergenic
960380585 3:116955596-116955618 ATTTCTAGCCCAGCATCACATGG - Intronic
960667102 3:120119968-120119990 GTCTCCAGACCAGCATCACCTGG - Intergenic
961425367 3:126841704-126841726 GAGATCAGCCCAGCAACATAGGG + Intronic
961473663 3:127134148-127134170 GTGGCCTGTCCAGCCTCACAGGG + Intergenic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
966853176 3:184176875-184176897 GTGACCTGCACAGCTCCACAGGG + Intronic
968637956 4:1692119-1692141 AAGACCAGCCCAGCATCACTTGG + Intergenic
969922598 4:10554211-10554233 GTGAACACCCCAACATTACAAGG + Intronic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973590954 4:52441040-52441062 GTGACAAGCCCTGCACCAGAAGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
975489239 4:74970371-74970393 GTGAGCCGTCCAGCCTCACATGG - Intronic
983373124 4:166889709-166889731 GTGACTTGCACAGCATCAAATGG + Intronic
985601338 5:836044-836066 CTGGCCAGCCCAGCATAGCAGGG - Intronic
986496177 5:8344214-8344236 GAGCCCATCCCAGCATAACATGG - Intergenic
989710921 5:44396284-44396306 GTGAGCTGCCCAGGATGACAGGG + Intergenic
991104590 5:62830105-62830127 GACAACAGGCCAGCATCACAGGG + Intergenic
994106905 5:95959575-95959597 GTGAAGAGACCAGCATCAGACGG - Intronic
994236416 5:97368687-97368709 ATGACAGGCCCAGCCTCACAGGG + Intergenic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
998164206 5:139833269-139833291 GTGACATGCCCACGATCACAAGG - Intronic
999122116 5:149217648-149217670 CTGCCCAGCCCACCATCCCAGGG + Intronic
999319769 5:150606675-150606697 GTGACCTGCCCACAGTCACAAGG + Intronic
999730103 5:154470559-154470581 GGGACTTGCCCAGCATCTCAGGG - Intergenic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001299866 5:170525756-170525778 GTGGACAGTGCAGCATCACATGG - Intronic
1001828082 5:174762430-174762452 GTCATAAGCCCAGCATCACACGG - Intergenic
1001951550 5:175820147-175820169 GTGACCAGTCCAGGGCCACACGG - Intronic
1002135249 5:177103770-177103792 GTGACTGGCCCAGGGTCACAGGG + Intergenic
1003946179 6:11078026-11078048 GCGACAAGACCAACATCACAGGG + Intergenic
1006929607 6:37679845-37679867 GACACCTGCCCATCATCACATGG + Intronic
1007997072 6:46319136-46319158 GTGACTAGCCCAGCTTTGCAAGG - Intronic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1011753966 6:90480322-90480344 GTGAGGAGCCCAGAATCAAAGGG - Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1014688138 6:124529615-124529637 GTCAGCAGCCCAGAATCACCTGG + Intronic
1018290460 6:162287900-162287922 GTGACTAACCCAGCAGCAGATGG + Intronic
1018964610 6:168474733-168474755 GTGACGAGCCCAGCAGAACAGGG + Intronic
1022060954 7:26794583-26794605 CTGCCCAGCCCACCATCACTGGG + Intronic
1022163460 7:27734689-27734711 TTCACCAGCTCAGCAACACAAGG - Intergenic
1023077524 7:36498849-36498871 GTCATCAGACCAGCATCACCTGG - Intergenic
1023511261 7:40955948-40955970 TTGACCAGCCTTGTATCACAGGG + Intergenic
1024117698 7:46209148-46209170 GTGAAAAGCCCTGGATCACAGGG + Intergenic
1024231409 7:47366725-47366747 GTGGCCTGCCCAGGTTCACATGG - Intronic
1027352735 7:77328056-77328078 GTGACTTGCCCAGGAGCACATGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1029106238 7:98178899-98178921 GTGACCAGCCCAGCATCACATGG + Intronic
1029188039 7:98753441-98753463 CTCACCTGCCCTGCATCACAAGG - Intergenic
1029402483 7:100354579-100354601 GAGACCAGCCCAGCCAAACATGG - Intronic
1033980043 7:147152860-147152882 GAGAACAGCCCAGGATTACACGG + Intronic
1034477369 7:151293486-151293508 GGGAGCACCCCAGCCTCACAGGG + Intergenic
1034990308 7:155543772-155543794 TAGCCCAGGCCAGCATCACACGG - Intergenic
1034991112 7:155548702-155548724 GGGCCCAGCCCAGCATCTCCAGG + Intergenic
1035067917 7:156121618-156121640 GGGCCCAGCCTGGCATCACAGGG - Intergenic
1035535000 8:384232-384254 GTGGCCAGCTGACCATCACAGGG + Intergenic
1035728910 8:1841506-1841528 GTGTCCAGAGCAGCATCACCAGG + Intronic
1037428553 8:18784762-18784784 GTGGGCATCCCAACATCACAGGG - Intronic
1038146539 8:24902045-24902067 GTGAACAGGACAGCATCAGAAGG - Intergenic
1040465773 8:47693702-47693724 GTGACCAGCCCCGGAACACAGGG + Intronic
1041163483 8:55069060-55069082 GTGACCAACCCACCATCTGAGGG + Intergenic
1044392032 8:91662748-91662770 CTGCCCAGCCCATCACCACATGG - Intergenic
1044629531 8:94265188-94265210 ATAACCAGCCCAGGGTCACAGGG + Intergenic
1044808424 8:96032503-96032525 GTGACAAGCCCAAGGTCACATGG + Intergenic
1044823870 8:96178161-96178183 GTGACCATCCCAGCTTCGCGGGG - Intergenic
1045517990 8:102877678-102877700 GTGAGCAGACCAGAATCGCAGGG + Intronic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1048743471 8:137587787-137587809 GTGACCAGACCAGGATCAGCTGG - Intergenic
1049107052 8:140620664-140620686 GAGACCAGCCCAGGCTAACATGG + Intronic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1049852146 8:144838455-144838477 GTGTGCTGCCCAGCATGACAAGG + Intronic
1050086152 9:1967847-1967869 TTGACTAGCCCAAGATCACAGGG - Intergenic
1051408322 9:16763053-16763075 GTGACCATCTAAGCAGCACAGGG - Intronic
1051695037 9:19759287-19759309 GTGTCCAGCCCATCAACAGATGG + Intronic
1052324505 9:27203098-27203120 GTGACCCTCCCAGAATCTCAAGG + Exonic
1053136271 9:35652092-35652114 GAGACCAGCCTGGCAACACAGGG - Intergenic
1053403196 9:37846785-37846807 GTGAAAAGCCCAGAATCAAATGG + Intronic
1055335474 9:75229286-75229308 CTGCCCAGCCCACCATCACTGGG + Intergenic
1055424339 9:76178440-76178462 GTGGCTTGCCCAGTATCACATGG - Intronic
1057441435 9:95086494-95086516 GTGAGCAGGCCAGCGTCACACGG + Intronic
1059331473 9:113538334-113538356 GTGACCAACCCAGGATCAGTGGG - Intronic
1059647723 9:116283898-116283920 TTGACCAGCCCCGAAGCACAAGG + Intronic
1060204717 9:121675691-121675713 GTCACCAGCCCAAGGTCACAGGG - Intronic
1060207861 9:121693189-121693211 GGGACCTGCCCAGCGTCACCAGG - Intronic
1061006915 9:127933426-127933448 CTGAGGAGCCCAGCATCACATGG + Intergenic
1061291094 9:129650739-129650761 GTGACTAGCCCAAGATGACAAGG + Intergenic
1061366553 9:130174967-130174989 TAGCCCAGCCCAGCACCACAAGG - Intronic
1061930989 9:133833068-133833090 GTGGCCAGCCCAGCATCAAAGGG + Intronic
1062021835 9:134323231-134323253 GTGACCAGCTCAGGACCACAGGG + Intronic
1062129119 9:134883246-134883268 CTGCCCAGCCCAGGATCAAAGGG - Intronic
1203745023 Un_GL000218v1:36770-36792 GTGCCCACCCCAGCCTCAGAGGG - Intergenic
1203565083 Un_KI270744v1:82714-82736 GTGCCCACCCCAGCCTCAGAGGG + Intergenic
1189307856 X:40000623-40000645 TTGACCAGCACTGAATCACATGG + Intergenic
1190775612 X:53550101-53550123 GTGACTTGCCCTACATCACACGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193615657 X:83685230-83685252 TTAACCAGCCTTGCATCACAGGG + Intergenic
1194578482 X:95641989-95642011 CTGACAAGCTCAACATCACATGG + Intergenic
1195136154 X:101909068-101909090 GTTACCAGCTCAGCCACACAAGG + Intronic
1197625217 X:128794397-128794419 TTGACCAGCCTTGCATCCCAGGG - Intergenic
1198228620 X:134669339-134669361 GTAACTTGCCCAACATCACACGG - Intronic
1201158359 Y:11151809-11151831 GTGCCCACCCCAGCCTCAGAAGG - Intergenic