ID: 1029107137

View in Genome Browser
Species Human (GRCh38)
Location 7:98187207-98187229
Sequence CTGCTTTTCTAAAGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029107137_1029107143 15 Left 1029107137 7:98187207-98187229 CCCATTTTCCTTTAGAAAAGCAG 0: 1
1: 0
2: 1
3: 34
4: 407
Right 1029107143 7:98187245-98187267 CATATTCTGTGCCTCCCACAGGG No data
1029107137_1029107142 14 Left 1029107137 7:98187207-98187229 CCCATTTTCCTTTAGAAAAGCAG 0: 1
1: 0
2: 1
3: 34
4: 407
Right 1029107142 7:98187244-98187266 TCATATTCTGTGCCTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029107137 Original CRISPR CTGCTTTTCTAAAGGAAAAT GGG (reversed) Intronic
901388022 1:8923902-8923924 CTGATTTTTTAACGGAGAATGGG - Intergenic
901777942 1:11573510-11573532 CTGCTTTCCTCAAGGTAAACTGG + Intergenic
903202859 1:21756734-21756756 TTGGTTGTTTAAAGGAAAATGGG - Intronic
904512293 1:31022163-31022185 CTGCTCATCTAAAAAAAAATGGG + Intronic
907179175 1:52553936-52553958 CTGCCTTTTCAAAGGAAAAAAGG - Intergenic
908460734 1:64346285-64346307 GTGGGTCTCTAAAGGAAAATTGG - Intergenic
909273669 1:73656975-73656997 ATGCTTTTCTACAAGAAAATGGG + Intergenic
909467236 1:75985783-75985805 CTCCTTTTATAAAGCTAAATAGG + Intergenic
911328691 1:96499805-96499827 CTTCTTTACTAAAGCAAAACTGG + Intergenic
912088531 1:106040826-106040848 CTGGTTTTAAAAATGAAAATTGG - Intergenic
914265154 1:146032284-146032306 ATGTTTTTAAAAAGGAAAATAGG + Intergenic
915289954 1:154876851-154876873 CTGCTTTGCTAAAGAAAAACTGG + Intergenic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916554412 1:165881583-165881605 CTTCTTATGTAAAGTAAAATAGG + Intronic
916692886 1:167208032-167208054 CTGATCTTCAAAAGGAAAACAGG - Intergenic
917037981 1:170770310-170770332 CTGCTCTTCCAAATGAAACTGGG - Intergenic
917211666 1:172638008-172638030 CTGAATTTTTAAAGGAAATTCGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
918125346 1:181578914-181578936 CTCCTTTCCTAAAGGAAATTAGG - Intronic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
919985142 1:202668687-202668709 CTGCTTTTATTCTGGAAAATGGG - Intronic
920142405 1:203827369-203827391 TTACTTTTATAAAGGAAAATTGG - Intronic
921214638 1:212926662-212926684 CTGCTTTTCTTACAGGAAATGGG - Intergenic
922033004 1:221822476-221822498 CTCCTTTTCCAAATGAAAACTGG - Intergenic
922168127 1:223132632-223132654 TTGTTTTCCTAAGGGAAAATAGG + Exonic
922517751 1:226221246-226221268 CAGTTTTTCAATAGGAAAATGGG - Intergenic
922921536 1:229309323-229309345 CTGCCTTTTCAAAGGAAAAGAGG + Intergenic
924833873 1:247628615-247628637 CTGCTTTTCTCAAGTAGAAAGGG + Intergenic
924865586 1:247976147-247976169 TTGTTTTTCTAAAGACAAATTGG - Intronic
924869271 1:248023386-248023408 TTGTTTTACTAAAGGCAAATTGG - Intronic
924870605 1:248039906-248039928 TTGTTTTTCTAAAGCCAAATTGG - Intronic
1062841706 10:678284-678306 CTGCTTTTCCAGAGGAAAGCTGG - Intronic
1063593761 10:7413994-7414016 CTGCTTTTTTAAAGTAAAGAAGG + Intergenic
1064227112 10:13496586-13496608 TTGATTTGCTAAAGGAAAAATGG + Intronic
1064461466 10:15538564-15538586 CTGCTTTTCTAAAGTGACATAGG - Intronic
1065241524 10:23709587-23709609 CTTCTTTCCTAATGGAAAAATGG + Intronic
1068307050 10:55224906-55224928 CTGCTTTTCAAGATGAGAATAGG - Intronic
1068422151 10:56808160-56808182 CTGCTTTTCTCAAGCAGAAGAGG + Intergenic
1071316595 10:84406819-84406841 CTGCATTTTTACAGGAAAAGAGG - Intronic
1071498380 10:86186519-86186541 CTGCTTCTCTAAGGGACAATGGG + Intronic
1071661842 10:87512026-87512048 CTGTTTTCCTAAAGGAAAATGGG - Intronic
1071793088 10:88976964-88976986 CTGCTAATCTAAAGGAATCTGGG - Intronic
1072429048 10:95355401-95355423 CTGTGTTTCGAAAGAAAAATTGG - Intronic
1072855757 10:98944316-98944338 CAGCATTTCTTAAGGCAAATGGG + Intronic
1073184086 10:101605126-101605148 CTGCTTTTCTAAAGGCGGACTGG + Intronic
1073552466 10:104415757-104415779 CTCCTTTTCTAAAGTCAGATTGG - Intronic
1074961796 10:118453094-118453116 CTGCCTTGCTAAAAGAAAACAGG + Intergenic
1075372443 10:121949459-121949481 CTTCTTTTCTAATGGGGAATAGG - Intergenic
1076133301 10:128028467-128028489 CTGCATTTCTTAGGAAAAATGGG + Intronic
1076254570 10:129011994-129012016 CTTCTCTTTTAAAGGAAAATAGG - Intergenic
1076256446 10:129029710-129029732 CTGCTTTGCAAACAGAAAATTGG - Intergenic
1079630815 11:22672521-22672543 TTGCTTTTATAGAGCAAAATAGG + Intronic
1080148767 11:29023166-29023188 GTGCTTTCTCAAAGGAAAATGGG + Intergenic
1080380373 11:31764615-31764637 CTGGATTTTTAAATGAAAATGGG - Intronic
1080428952 11:32181215-32181237 CTGCTTTTGTAAAAGGAAAAAGG + Intergenic
1080998393 11:37634741-37634763 CTTCTTTTTTAAAGTTAAATTGG - Intergenic
1081834065 11:46139347-46139369 ATGCTTTTATAAAATAAAATAGG - Intergenic
1082630427 11:55535594-55535616 CAGCCTTTCATAAGGAAAATTGG + Intergenic
1083972702 11:66090654-66090676 CTGATTTTCTAAATGAAAGTAGG + Intronic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1086775201 11:90822410-90822432 TTGCTTTTCCTAGGGAAAATCGG + Intergenic
1087032028 11:93715536-93715558 CTGCTTTTCTCAAGCAGAAGGGG + Intronic
1087165392 11:94998124-94998146 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087168392 11:95026300-95026322 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087391769 11:97544130-97544152 AAGCTTTTCTATTGGAAAATAGG - Intergenic
1087862628 11:103179844-103179866 CTGATTTTCAAAAATAAAATTGG - Intronic
1088183291 11:107136139-107136161 CTGCTTAACTAAAGCAACATGGG + Intergenic
1088548508 11:110986292-110986314 TTGCTTTTCTAAAGTAGATTTGG - Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089071177 11:115700934-115700956 TTTCTTTTTTAAAGGAGAATGGG + Intergenic
1089813016 11:121147280-121147302 CTCCTTTTCCAGATGAAAATGGG - Intronic
1090053870 11:123404971-123404993 CTGATTTTCAGCAGGAAAATGGG + Intergenic
1090310139 11:125729332-125729354 CTGCCTGTCTAAAAGAAAGTTGG + Intergenic
1090500975 11:127260906-127260928 TTACTTTTTTAAAGTAAAATAGG + Intergenic
1091265267 11:134265837-134265859 CTGCTTTTTAAAAGCCAAATTGG - Exonic
1094770605 12:33653857-33653879 ATGGTTTTCTGAAGGAAAAAAGG + Intergenic
1097585183 12:61506791-61506813 CTGCTTTGAGAAAAGAAAATGGG - Intergenic
1098423136 12:70325775-70325797 CTGCTTTGCAAATGGAAAAGGGG + Intronic
1098661412 12:73099388-73099410 CTACATTTCTACAGAAAAATAGG - Intergenic
1099138405 12:78938219-78938241 CAGCTTTTCTCCAGGAAAATAGG + Intronic
1099208611 12:79757431-79757453 CTGATATTCTAAGGAAAAATAGG - Intergenic
1099495303 12:83339620-83339642 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1100090061 12:90957304-90957326 CTGCTTCTCTTAAGAAAATTCGG - Intergenic
1100675469 12:96861947-96861969 GTGTTTTTCTAAAGCTAAATTGG + Intronic
1100883396 12:99042818-99042840 CTGCTTTTCTAAAAGCACTTTGG - Intronic
1101119978 12:101569075-101569097 CTGTATTTCTAAAGTAAAAATGG - Intronic
1102734326 12:115144845-115144867 CTGATTATCTCAAGGAAGATGGG - Intergenic
1103382992 12:120509407-120509429 TGGCTTTTCTACAGGAAAAGGGG - Intronic
1103593099 12:122006183-122006205 CTGCTTTTGTCAAGGAAGTTGGG - Intergenic
1104526480 12:129528215-129528237 GTGTTTTTCTTAAGGATAATTGG - Intronic
1104996539 12:132661312-132661334 CTGCTTCTCTAAAAGGAAAATGG + Intronic
1106134752 13:26965758-26965780 TTGCTTTTCTAGATGAGAATGGG + Intergenic
1107036129 13:35904632-35904654 CTTCTTTCCTAAAGGCAAAAGGG - Intronic
1107176451 13:37405060-37405082 CTGCCTTACCACAGGAAAATAGG - Intergenic
1107858644 13:44639827-44639849 ATGATTTTTTAAAAGAAAATGGG - Intergenic
1108465070 13:50707078-50707100 ATACTTTTTTAAAGGAAAATAGG + Intronic
1108679765 13:52769530-52769552 CTGCTTCTTTAAAGAAAAGTTGG - Intergenic
1109524241 13:63555186-63555208 TTGCTTTTCTAAATGTCAATGGG - Intergenic
1109920310 13:69048852-69048874 ATGCATTTCTAAATGAATATTGG - Intergenic
1110006274 13:70275172-70275194 ATGCTTTTGGAAAGGAAGATTGG + Intergenic
1110092833 13:71475254-71475276 CTTTTTTTTTAAAGGACAATAGG - Intronic
1110246334 13:73328479-73328501 CTGCTTTACAAAAGAAAAAAAGG + Intergenic
1110341343 13:74394452-74394474 CTGCTTATGTGAATGAAAATTGG - Intergenic
1110360883 13:74624046-74624068 CTGCTATTCCATAGGAAAGTGGG - Intergenic
1110387563 13:74931772-74931794 ATACTCTTCCAAAGGAAAATAGG + Intergenic
1111252311 13:85618568-85618590 CTGCTTTCCATAAGGAAAAGTGG - Intergenic
1111346748 13:86966953-86966975 CTGCTTTTTTCTAGCAAAATTGG - Intergenic
1111384980 13:87513479-87513501 CTTCTTTTCTAAAGGAGAGAAGG - Intergenic
1111705444 13:91743169-91743191 CTGACTTTCCAAAGGAAAAGGGG - Intronic
1112428207 13:99324398-99324420 CTGCTTTTCTCATGGCAAAGGGG - Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1113664739 13:112133490-112133512 CTGCTTTACAAAATGAAAATGGG - Intergenic
1113776924 13:112953220-112953242 CTGCTTTTCTGTAGGAATGTGGG + Intronic
1113963264 13:114137635-114137657 ATTCTTTTCAAAAGGAATATTGG + Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1114750179 14:25195451-25195473 TTCCGTTTCTAAAGGAAATTAGG + Intergenic
1114865549 14:26590338-26590360 CTGCTTTTCAAAATAAAACTGGG - Intronic
1115372189 14:32629265-32629287 GTTCTTTTCCAAAGGAAAAAAGG - Intronic
1116077274 14:40126945-40126967 CTTCTTTTCTAATGGAACCTGGG + Intergenic
1116145813 14:41067349-41067371 TTGCTTTTGAAAAGGAAACTTGG - Intergenic
1117280981 14:54240770-54240792 CTGCTTGTCAGAAGGAAATTTGG - Intergenic
1117316275 14:54573875-54573897 CTGCTTTTATGTAGGAACATGGG + Intronic
1117646385 14:57857796-57857818 CTGCACTTCTAAAGATAAATAGG + Intronic
1118071330 14:62249577-62249599 TAGCTTTTCTAAAGTAAAAGGGG + Intergenic
1118117776 14:62800471-62800493 CTCCTTTTCTAAAAGAAGGTTGG - Intronic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1119749989 14:77070387-77070409 CTGCTATTTTAAAGGCAGATAGG - Intergenic
1121247383 14:92471783-92471805 TTGGTTCCCTAAAGGAAAATTGG + Intronic
1121698262 14:95930448-95930470 CAACTTTTCTGGAGGAAAATGGG - Intergenic
1122723971 14:103738615-103738637 CTGCTTTGCATAAGGAAAACAGG - Intronic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123159279 14:106262161-106262183 GTGTTTTTCTAAAGGACATTAGG - Intergenic
1124391383 15:29261552-29261574 CTTCTTTTTTAAAGGACACTTGG + Intronic
1124907783 15:33887477-33887499 CTACCTTTCTAGGGGAAAATGGG + Intronic
1125027044 15:35041293-35041315 CTCCTTTTTCAAAGGAAAACTGG - Intergenic
1125244809 15:37622794-37622816 CTGCTATTCTTTAGGTAAATGGG + Intergenic
1125791216 15:42367202-42367224 CTGCTTGTGTAAACCAAAATAGG - Intronic
1126241903 15:46454542-46454564 GTGCTTCTCTCAAGGAAAATGGG + Intergenic
1126256487 15:46632630-46632652 TTGGATTTCTAAAGGAAACTTGG + Intergenic
1126324616 15:47463450-47463472 TTGCATTTACAAAGGAAAATAGG + Intronic
1126456265 15:48865459-48865481 TTTCTTTCCTATAGGAAAATGGG - Intronic
1126790222 15:52214224-52214246 CTACTTTTCTAATAGAAATTTGG + Intronic
1127696102 15:61449374-61449396 TTGCATTTCTAATGGAAAAGAGG + Intergenic
1128936595 15:71751084-71751106 GTCCTTTTCTAAAGGACAGTGGG - Intronic
1129075359 15:72990677-72990699 CTGATTTCCTAAATAAAAATGGG - Intergenic
1130205379 15:81870535-81870557 ATGCGTTCCTGAAGGAAAATGGG - Intergenic
1131971339 15:97896548-97896570 CAGCATTTCCAAAGGAAAATTGG - Intergenic
1133366782 16:5216480-5216502 CTGCTTCTCTCAAGGAAATCAGG - Intergenic
1133426567 16:5695793-5695815 ATGCTCTTCTAAAGGAAAGGAGG + Intergenic
1134340441 16:13340318-13340340 TTCCTCTTCTAAAGGAATATGGG + Intergenic
1138188438 16:54995104-54995126 CTGATTTTCTAAGAGAAACTGGG + Intergenic
1139104015 16:63803739-63803761 CTTCCTTTCAGAAGGAAAATAGG + Intergenic
1139907061 16:70373491-70373513 CTGTTTTTGTAAAAGAAAAATGG - Intergenic
1141184361 16:81776480-81776502 CTTCTTTTCCCAAGGATAATAGG - Intronic
1142588605 17:990258-990280 CTGCTTTGCTAAGGGATAAAAGG - Intergenic
1142934290 17:3314703-3314725 CTCCTTATCTAAAGTAAAAGTGG - Intergenic
1144136496 17:12300370-12300392 CTACTTTCCTCAAGGGAAATAGG + Intergenic
1144384958 17:14740831-14740853 CTGCTTTTCAAATGGAGAACAGG - Intergenic
1144487898 17:15682728-15682750 CTGCCTTTCTGAAGGATAAGGGG - Intronic
1145915090 17:28568785-28568807 CTTGTTTTCTAAACAAAAATTGG - Intronic
1147531999 17:41288028-41288050 CTGCCTTTTTAAAGAAACATTGG + Intergenic
1147909351 17:43846070-43846092 GTGCTTTTCTAAAGCAGAAGGGG + Intergenic
1149234889 17:54578262-54578284 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1150412385 17:64956164-64956186 TTGTGTTTCTAAAGAAAAATGGG - Intergenic
1150799510 17:68269459-68269481 TTGTGTTTCTAAAGAAAAATGGG + Intronic
1152506182 17:80750220-80750242 GTCCTTTTGAAAAGGAAAATAGG + Intronic
1153363304 18:4224305-4224327 CTGCTTTTCTCAAGAAGAAGGGG - Intronic
1153808406 18:8730942-8730964 CTGCTTTTCTTAAAAATAATTGG + Intronic
1155769716 18:29681365-29681387 TTGCTTTTGTAAAGGAATACAGG - Intergenic
1156187265 18:34677679-34677701 ATGCTTTTTTAAAAAAAAATTGG - Intronic
1157529700 18:48410105-48410127 CTGCTTTTCTACCCGAAAGTCGG + Intronic
1158218643 18:55127268-55127290 CTGGTTTTATAAAGGTCAATTGG + Intergenic
1158473393 18:57758695-57758717 CTACTTTTGTAAAAGAAAAAAGG - Intronic
1158668710 18:59455595-59455617 ATTCTTTGCTAAAGGAAAACTGG + Intronic
1158785376 18:60705705-60705727 GTGCTTTTTTAAAGCAGAATGGG - Intergenic
1160357834 18:78243645-78243667 ATACTTTATTAAAGGAAAATGGG - Intergenic
1162722278 19:12669576-12669598 CTTCCTTTCAAAGGGAAAATGGG + Exonic
1162784788 19:13027839-13027861 CTGCTTTTGTAGAGGAGACTCGG - Intronic
1164954041 19:32365737-32365759 TTGTATTTCTAAGGGAAAATGGG - Intronic
1165184275 19:34003445-34003467 CAGTTTTTCTACAGGAAATTAGG - Intergenic
1165961288 19:39536728-39536750 CTGCAAATTTAAAGGAAAATAGG + Intergenic
1166063563 19:40342939-40342961 CTGCTAATGTAAGGGAAAATTGG - Intronic
1166564649 19:43756193-43756215 GTGCTTTAGGAAAGGAAAATGGG - Intergenic
925096290 2:1206723-1206745 CTGATTTTATAAAGAAAAAATGG + Intronic
927165024 2:20310031-20310053 CTTATTTTTTAAAGAAAAATTGG - Intronic
928242027 2:29594875-29594897 CTATTTTTCTAAACAAAAATGGG + Intronic
928889706 2:36189313-36189335 CTGCTTTACAAAAGGGATATTGG - Intergenic
929239735 2:39641964-39641986 CTGGTGTTCAAAAGCAAAATTGG - Intergenic
929349478 2:40931493-40931515 CTGATTATCTCAAGGCAAATAGG - Intergenic
929509605 2:42556394-42556416 CTGCCTTACTGAAGAAAAATGGG + Intronic
929790483 2:45018839-45018861 CTGCTTCTCTACAGGAGCATAGG - Intergenic
930386799 2:50707095-50707117 AATATTTTCTAAAGGAAAATAGG + Intronic
930905716 2:56564479-56564501 CTGTTTTAGTAAAGGAAGATAGG - Intergenic
931467127 2:62499773-62499795 CTTTTTTTCTATAGGGAAATGGG - Intergenic
933083249 2:78021212-78021234 CTAATTTACTAAAGGAAAATTGG + Intergenic
936009456 2:108916152-108916174 TTGCTCTTATAAAGGAAATTAGG - Intronic
936343939 2:111661037-111661059 CTGGGTTTCAAAAGGAAAAATGG - Intergenic
937145105 2:119637858-119637880 CTGCTTTTGAAAACAAAAATAGG - Intronic
937665330 2:124480886-124480908 CTTCCTTTCTTCAGGAAAATTGG + Intronic
937670386 2:124531941-124531963 CTGGGTTTCTAAAGGCAAATGGG + Intronic
938609748 2:132935447-132935469 CTGATTTCTGAAAGGAAAATAGG + Intronic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
939531555 2:143369359-143369381 TTGCCATTTTAAAGGAAAATTGG - Intronic
939941616 2:148358470-148358492 CTCCTATTATAAAGCAAAATAGG + Intronic
940337532 2:152544841-152544863 CAGCTGATCTAAAGGAAAATTGG - Intronic
942433708 2:175946553-175946575 CTGCATTTTTGAAGGAAAACAGG + Intronic
942672092 2:178387174-178387196 CTGCTTTTCTAAATCATAAATGG + Intronic
942873090 2:180760162-180760184 CTGCTTTTTAAAAGCAAATTAGG - Intergenic
945448525 2:209966622-209966644 CAGATTTTCTGAAGGAGAATTGG - Intronic
948980990 2:241494680-241494702 CTGCTTCTCTAGAGGTACATGGG - Exonic
949017700 2:241722729-241722751 ATTCATTTCTAAAGGACAATGGG + Intronic
1168783594 20:517192-517214 CCCCTTTTGTAAAGGGAAATGGG - Intronic
1169184289 20:3600771-3600793 TTGCTTGTATTAAGGAAAATTGG + Intronic
1169497588 20:6130011-6130033 TTACTTTTCTAAAGTAAAGTTGG - Intergenic
1169972255 20:11280568-11280590 CTGTTTTTCTTTAGGAACATTGG + Intergenic
1170617004 20:17961646-17961668 CTGCTTTTGGAATGGAAACTAGG - Intronic
1170864108 20:20137798-20137820 CTGCTTTTCTGAAGCAGAAGTGG + Intronic
1173268046 20:41504938-41504960 CTGGTTGTCTAAGAGAAAATGGG - Intronic
1173307707 20:41865737-41865759 CTACTTTTCTATAGCACAATAGG + Intergenic
1175506692 20:59491035-59491057 CTTTTTCTCTAAAAGAAAATCGG - Intergenic
1176166208 20:63675331-63675353 GTGCGATTTTAAAGGAAAATGGG - Intronic
1177277680 21:18935312-18935334 CTGTTTCTCTAAAGGGAAAAGGG - Intergenic
1177569650 21:22870915-22870937 CTGCTTTTCTCAAGCAGAAGGGG + Intergenic
1177791487 21:25726959-25726981 GTGCTAATCTAAAAGAAAATTGG - Intronic
1179098140 21:38333969-38333991 CTCCTTTTGTAAAGGAACATGGG + Intergenic
1179199468 21:39203150-39203172 TAGCTGTTTTAAAGGAAAATAGG - Intronic
1179285051 21:39970051-39970073 CTTCAGTTCTATAGGAAAATTGG - Intergenic
1181777653 22:25171065-25171087 CTTCTTTTAAAAAGGAAATTAGG + Intronic
1182092147 22:27603083-27603105 CTGTTTTTCTATTGGAACATTGG - Intergenic
1183797951 22:40135925-40135947 CAGCTTCTCTAAAAGAAAAGAGG + Intronic
1184680185 22:46068322-46068344 CTGCTTTACCAAATAAAAATTGG + Intronic
1185130911 22:49038091-49038113 CTGTCTTTCTACAGGAAAACGGG + Intergenic
949335417 3:2969493-2969515 ATGATTTCCCAAAGGAAAATTGG + Intronic
949476291 3:4449085-4449107 CACCTTATCTTAAGGAAAATGGG - Intronic
949645798 3:6092357-6092379 CTCATTTTCTAAAGGAAGCTTGG + Intergenic
952652478 3:35743198-35743220 TTGCTTTTCTAATGGAAACAGGG - Intronic
952739165 3:36718893-36718915 TTACTTTTCTAAATAAAAATAGG + Intronic
954334109 3:49906189-49906211 CTCCTTTTCCAAAGCAGAATTGG + Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
956090446 3:65661012-65661034 CTAATTTTCTAAAGTAAATTAGG + Intronic
956928548 3:74016426-74016448 CTGTTTTTCTCCAGTAAAATGGG - Intergenic
957221912 3:77393320-77393342 GTGTTTTTCCAAAAGAAAATAGG - Intronic
957526959 3:81390258-81390280 GTGCTTTTCTATAGGAAATCTGG + Intergenic
959530978 3:107433382-107433404 CTAATATTATAAAGGAAAATGGG + Intergenic
960428722 3:117542563-117542585 CTGCTATTCTGAACAAAAATTGG + Intergenic
960492756 3:118336836-118336858 CTGACTTTATAAAGTAAAATAGG + Intergenic
960694523 3:120383142-120383164 CTGGTTTTCTAACTGAAACTTGG - Intergenic
961989431 3:131171957-131171979 ATGCTTATATAAAAGAAAATAGG + Intronic
963254230 3:143128931-143128953 ATTCCTCTCTAAAGGAAAATAGG + Intergenic
964332259 3:155616659-155616681 CTGCTTGCCTACAGGAAAAGGGG + Intronic
965253414 3:166371042-166371064 CTGCTTCTCTCAAGTATAATGGG + Intergenic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
967067652 3:185934609-185934631 ATCCTTTTTTAAAGGAAATTTGG + Intronic
967253612 3:187567784-187567806 CTGCTTAGCTAAAAGAAATTGGG - Intergenic
967264377 3:187677427-187677449 CTGGTTTTAGGAAGGAAAATAGG - Intergenic
967452380 3:189640860-189640882 TTGCTTTGCAAAAGTAAAATTGG + Intronic
967554451 3:190837886-190837908 CAGCGTATCTAAAGGAATATGGG - Intergenic
970226176 4:13859402-13859424 CTGAATTTCAAATGGAAAATGGG - Intergenic
970703258 4:18768557-18768579 CTGCTTTACTAAAAGTAAATTGG + Intergenic
971388630 4:26164763-26164785 GTGTTTTTCTACTGGAAAATGGG + Intronic
971540870 4:27814633-27814655 CTGATTATCTAAAGCAAAAATGG + Intergenic
971567828 4:28168073-28168095 CTGCTTTTCTGAAGTAGAGTGGG + Intergenic
971752816 4:30673117-30673139 TTGCTATTCTTTAGGAAAATTGG - Intergenic
971949791 4:33330075-33330097 CTGCTGTTATAAAGTAAATTTGG + Intergenic
972367481 4:38390056-38390078 CTGCTCTTCTAAAGGGAATAGGG - Intergenic
974177853 4:58346566-58346588 CTGCTTTTGGGAAGGAAGATGGG + Intergenic
975020139 4:69475864-69475886 ATGTTTTTTTAAAGGCAAATAGG - Intergenic
975365576 4:73524146-73524168 CTGCTTTTCTCAAGCAAATGGGG + Intergenic
975469740 4:74751978-74752000 ATCCTTTCTTAAAGGAAAATGGG - Intronic
976057828 4:81089442-81089464 CTGATTGTGGAAAGGAAAATGGG + Exonic
976824526 4:89246293-89246315 CTGGTTTTCTAAACGCAAAATGG + Exonic
976908231 4:90266934-90266956 CTGCTTTTCTCAAGCAGAAGAGG - Intronic
977071381 4:92392561-92392583 CTGATTTTCTGAAAGTAAATTGG + Intronic
977289775 4:95151896-95151918 CTGCATTTTTAAAGGAGAAGAGG + Intronic
977767865 4:100822219-100822241 CTCCTTTTCTAAGGGAGCATAGG - Intronic
977966773 4:103160143-103160165 CTACTTGTCTAAAAGAAAAATGG - Intronic
979199261 4:117957281-117957303 CTCCTTTTCTATAGGCAAAGTGG + Intergenic
979386305 4:120068833-120068855 CTTTTTTTTTAAAGGAAAATTGG + Intergenic
979430028 4:120618103-120618125 CTGCATTTCTAAGGAATAATGGG - Intergenic
979578468 4:122324428-122324450 CTGCTTCCCTAAAGGATAAGTGG + Exonic
980831466 4:138133813-138133835 GTGTTTCTCTAAATGAAAATGGG + Intergenic
981398994 4:144289667-144289689 CTGCTTGACTAAAGGAAGAATGG + Intergenic
981664404 4:147206818-147206840 TTGCATATCTAAAGGAAAATAGG + Intergenic
985235209 4:187865261-187865283 TTGATTTTTTAAATGAAAATAGG - Intergenic
986366278 5:7035427-7035449 ATGATTTTCTAAATTAAAATTGG + Intergenic
987108823 5:14665482-14665504 TTCCTTTTCAAAAGGAAAAGCGG - Intronic
987633124 5:20502807-20502829 CTACATTTATAAAGGAGAATTGG + Intronic
987854354 5:23400170-23400192 CAGCTTTTATAAAGAAAAAGAGG + Intergenic
988138608 5:27206742-27206764 CTGCTTTTCTGAATCAAATTAGG + Intergenic
988567018 5:32327619-32327641 TTGCTTTTAGAAAGGGAAATTGG + Intergenic
988791327 5:34610533-34610555 CTGCTTGTCAAAAAGGAAATTGG - Intergenic
989108334 5:37884396-37884418 CTGCTTTTGTGATGGAGAATGGG + Intergenic
990273203 5:54168036-54168058 CTGCTTTTGATAAGGAATATAGG - Intronic
990369648 5:55104398-55104420 CTGCTTTTAAAAAGGAAACTGGG - Intronic
991035738 5:62125539-62125561 TTGCTTTTCAAGGGGAAAATGGG + Intergenic
992739695 5:79760946-79760968 CTGTTTCTTTAAAAGAAAATCGG - Intronic
992769973 5:80037860-80037882 CTGCATTTCAAAAGGGAAATTGG - Intronic
993563870 5:89447923-89447945 CTGCATTTGTGAAGGAAATTGGG + Intergenic
993717135 5:91286598-91286620 TTACTTTTCAAAAGGAAAAACGG - Intergenic
993830688 5:92753828-92753850 CTGATTTTCCAAAGAAAACTAGG + Intergenic
993908587 5:93652243-93652265 CTGGTTTTTCAAAGGAAAATTGG + Intronic
994529961 5:100956797-100956819 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
995944004 5:117620117-117620139 CTGCTTTTAAAAAAGAAACTTGG + Intergenic
996322396 5:122233281-122233303 GTGTATTTCTGAAGGAAAATTGG + Intergenic
996594476 5:125185300-125185322 CTGCTTTTCTGAAGCAGAAGAGG - Intergenic
996840408 5:127842047-127842069 TTGCTTTTTGTAAGGAAAATGGG + Intergenic
996933047 5:128914283-128914305 CTCCTTTGTTAAAGGAAAGTTGG + Intronic
998956585 5:147444919-147444941 CTGCATTTGTAAAGCAAACTTGG - Intronic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
1000533123 5:162448388-162448410 ATGCTTTTCTAAATGTATATAGG + Intergenic
1001626297 5:173137590-173137612 CTGTTTTTATAAAACAAAATGGG - Exonic
1002691503 5:181053454-181053476 CAGCTTTTCTGAAGGGAAACGGG - Exonic
1002912366 6:1499802-1499824 CTGCTTTTCAGAGGGAAAAAGGG - Intergenic
1003152937 6:3568084-3568106 TGGCTTTTCTAAAAGGAAATGGG - Intergenic
1003513619 6:6801509-6801531 CTGCTTTTTAAATGGAAAACCGG - Intergenic
1004024494 6:11805672-11805694 CTAGGCTTCTAAAGGAAAATAGG + Intronic
1004111071 6:12719629-12719651 CTGCTTTTCTATTTTAAAATAGG - Intronic
1005268756 6:24140904-24140926 CTGCTGCTGGAAAGGAAAATTGG - Intronic
1005292056 6:24389540-24389562 CTGTTTTTAAAAAGGAAAATGGG + Intergenic
1006050223 6:31336525-31336547 CTGCTTTCCCAGAGGAAATTAGG + Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006150349 6:31983698-31983720 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006156650 6:32016436-32016458 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006758570 6:36439284-36439306 CTGCATTTGGAAAAGAAAATAGG - Intronic
1007997848 6:46327525-46327547 CAGCTTTTGAAAAGGTAAATGGG + Intronic
1008227298 6:48936372-48936394 CTGCTTTTCTCAAGCAGAAGGGG + Intergenic
1008948576 6:57128668-57128690 ATCCTTTTCTCAAGGAAAACAGG + Intronic
1009353159 6:62707620-62707642 CTGCTTTTCTCAAGCAGAAGGGG + Intergenic
1009683371 6:66926146-66926168 GTGCTTTTCTACTGGAAACTAGG - Intergenic
1009779018 6:68244868-68244890 CTGCTTATTTAAAGAAACATTGG + Intergenic
1010395736 6:75390110-75390132 CTACTTCTCTAAAGGAACACTGG + Intronic
1010764444 6:79762969-79762991 TTGCTTTTTTAAAAGAAAATGGG + Intergenic
1010870645 6:81033743-81033765 CTACTTATGTAAAGGAAATTTGG + Intergenic
1011814341 6:91171063-91171085 CTGTGTTCCTACAGGAAAATGGG - Intergenic
1014066839 6:117136956-117136978 CTGCTTACCCAATGGAAAATAGG + Intergenic
1014494732 6:122107284-122107306 CTGGTTATTTAAAGCAAAATGGG + Intergenic
1014660348 6:124162607-124162629 CTTCATTTCAAAAGGAGAATCGG + Intronic
1014700690 6:124683921-124683943 CTGGATTTCTAAAGGAGAACAGG + Intronic
1014819875 6:125975907-125975929 CTGCTTTTCCAAAGCAAAAGTGG + Intronic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1017609172 6:156166273-156166295 CTGTTTTTATAAAAAAAAATAGG - Intergenic
1017617981 6:156265429-156265451 CTTTTTTTCTATAGGATAATGGG - Intergenic
1017637660 6:156458882-156458904 CAGCAATTCTAATGGAAAATGGG - Intergenic
1017888892 6:158623138-158623160 TTGATTTTCAAAATGAAAATGGG - Intronic
1017991239 6:159491581-159491603 TTCTTTTTTTAAAGGAAAATTGG + Intergenic
1018421372 6:163643383-163643405 CTTTTTTTTTAAAGGAAAACAGG - Intergenic
1019089204 6:169511893-169511915 CTGCTTTCCTAAAAGGAAAGTGG + Intronic
1021382402 7:19983844-19983866 CTGCTTTTCTCAAGCATAAGTGG + Intergenic
1023471137 7:40521384-40521406 TTCCCTTTCTAATGGAAAATTGG + Intronic
1024319030 7:48046867-48046889 ATGCTTATCTAGAGGAAAACTGG + Intronic
1024644731 7:51361560-51361582 CTGCTTTTCTAGAAGAAATGAGG + Intergenic
1026439930 7:70435279-70435301 GTGCTTTTCTACAGGAAAAGAGG - Intronic
1027391781 7:77711066-77711088 TTGTTTTTCTAAATGATAATCGG - Intronic
1027433388 7:78137302-78137324 CTGTTTTTCGACAGTAAAATTGG + Intronic
1027479034 7:78671466-78671488 TTGCTTTTCAAAATGAAATTTGG - Intronic
1027941979 7:84694269-84694291 CTTCTTTTGTATAGCAAAATTGG + Intergenic
1028840395 7:95423536-95423558 CTCCTTATCTATAGCAAAATTGG + Intronic
1028862050 7:95663589-95663611 CTTCTTCTGTGAAGGAAAATTGG + Intergenic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1030029039 7:105352028-105352050 CTTATTTTCTCTAGGAAAATAGG - Intronic
1030124638 7:106142199-106142221 CTGATTTCCTAAAGGGAAAGTGG + Intergenic
1030747628 7:113186977-113186999 ATGCTGTTCTAAAGTAAAAGTGG + Intergenic
1030840941 7:114353490-114353512 CTGCTTTCATAATGGAAAAGGGG - Intronic
1031414178 7:121476126-121476148 TGGCTTTTTTAAAGGAAAAGAGG - Intergenic
1031648585 7:124257878-124257900 CTGCTTTGCTAAAGTATTATTGG + Intergenic
1031845619 7:126802710-126802732 CTGCAGCTCTTAAGGAAAATAGG - Intronic
1033168244 7:139060077-139060099 CTGCAGTTCTAAAGCAGAATAGG + Intronic
1033406612 7:141075081-141075103 CTGATTTAATCAAGGAAAATTGG + Intronic
1033420105 7:141198105-141198127 CTCCTTTTTCAAAGGAAAAGTGG + Intronic
1033900142 7:146127615-146127637 CTGCTTTTCTTAAGCCACATGGG + Intronic
1035926660 8:3735021-3735043 CTGTTTTTGTAAAACAAAATAGG + Intronic
1036155640 8:6339551-6339573 AAGCTTTTATGAAGGAAAATAGG - Intergenic
1037264629 8:17045046-17045068 TTTTTTTTTTAAAGGAAAATTGG + Intronic
1037568221 8:20135715-20135737 CAGCTCATTTAAAGGAAAATGGG - Intergenic
1038598420 8:28912255-28912277 CTGTATTTCTAAAGGAAGCTGGG + Intronic
1039157349 8:34576077-34576099 CAGTTTTTCTAAGTGAAAATTGG - Intergenic
1040993530 8:53377982-53378004 CTGCTTTGCTAACAGAAAAAAGG - Intergenic
1041616032 8:59907616-59907638 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1044407354 8:91843939-91843961 CTTTTTTTCCAAAGCAAAATTGG - Intergenic
1044517118 8:93152432-93152454 GTGCTTCTGTTAAGGAAAATTGG + Intronic
1044834490 8:96282391-96282413 CTGATTTTGAAAAGGAATATAGG + Intronic
1045043434 8:98249959-98249981 CTGCTTCTGGAAAGGAAAAATGG + Intronic
1045372026 8:101533948-101533970 CTTCTATTCTAAAGGAAAAGGGG + Intronic
1045835346 8:106514080-106514102 TTGCATTCCCAAAGGAAAATGGG - Intronic
1046229047 8:111329229-111329251 TTTCTATTCTAAAGGAGAATGGG + Intergenic
1046618431 8:116502130-116502152 CTCCTTTTCTTCAGGAAAGTGGG - Intergenic
1046785934 8:118266645-118266667 CTTCTTTTTTAAAGACAAATAGG - Intronic
1047084675 8:121503492-121503514 TTGCATCTCTAAAGGAAAGTAGG - Intergenic
1048019906 8:130528402-130528424 CTCCCTCTCTAAAGGAATATGGG - Intergenic
1048359395 8:133683942-133683964 GTGCTTTCTTAAAGGGAAATTGG - Intergenic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1048657634 8:136559277-136559299 ATGGGTTCCTAAAGGAAAATTGG - Intergenic
1048980416 8:139700831-139700853 ATGCATTTCTTAAGGAAAACTGG + Intronic
1050097345 9:2080430-2080452 CTGCTTTTTTTAGAGAAAATTGG - Intronic
1050384776 9:5076731-5076753 CTGCATTACTAGTGGAAAATAGG - Intronic
1050806375 9:9683564-9683586 TTGCTTTTGGAAAGGAAAAAGGG + Intronic
1050851802 9:10296945-10296967 CTTCTTTTCTAATGAAGAATGGG - Intronic
1052063544 9:23989413-23989435 CACCTTTACTAAAGGAAAACAGG + Intergenic
1053007895 9:34616106-34616128 CTGCTCCTCTAAAGCAAAAATGG + Exonic
1054721023 9:68604013-68604035 CTACTTTTCTATAGGATTATTGG - Intergenic
1055246514 9:74251202-74251224 CTACTTTTGGAAAAGAAAATAGG + Intergenic
1055617616 9:78089453-78089475 CTGCTTTTGTAAATAAAAAATGG + Intergenic
1055632877 9:78241349-78241371 CTGCTCTTGGAAATGAAAATAGG + Intronic
1055668272 9:78573827-78573849 CTTCATTTCTAAAGGCACATGGG - Intergenic
1055927667 9:81527312-81527334 CTGAATATCTAAAGGAAAAGTGG + Intergenic
1056088484 9:83180785-83180807 ATGCTTCTCCAAAGAAAAATTGG + Intergenic
1056696215 9:88856206-88856228 TTTTTTTTCTAAAGGGAAATGGG + Intergenic
1056716322 9:89033415-89033437 GTGGTTATCTAAAAGAAAATAGG - Intronic
1057493098 9:95537987-95538009 CTGCTTTTCTACAGGGAATTTGG - Intergenic
1057921523 9:99102210-99102232 CTGCTTTCCCAAAGAAAAACAGG + Intergenic
1058073330 9:100624173-100624195 CAGCTTTTCTGAAGCAAAATTGG + Intergenic
1058217612 9:102254575-102254597 TTCCTTTTCAAAAGGAAAAAGGG + Intergenic
1059136535 9:111812288-111812310 TTTCTTCTCTAAAGAAAAATAGG - Intergenic
1059241823 9:112812843-112812865 CTGTTGTTTTAAGGGAAAATGGG - Intronic
1059764229 9:117368423-117368445 CAGATTTTGTAATGGAAAATGGG - Intronic
1062180385 9:135188160-135188182 CTGCATTTCAAAAGGAAAGATGG - Intergenic
1203451841 Un_GL000219v1:124390-124412 CTGCTTTTGTAATGGAACGTGGG - Intergenic
1185562783 X:1072572-1072594 CCTCTTTTGAAAAGGAAAATAGG - Intergenic
1186608880 X:11119302-11119324 CTCTTTTTCTCAAGGAGAATAGG + Intronic
1186908033 X:14132256-14132278 CTCCTTCTCTATAGGAAAGTTGG + Intergenic
1187983688 X:24786944-24786966 CTGCTTTTAAAAAAGAAATTAGG - Intronic
1188254024 X:27937093-27937115 CTACTCTGCTAAAGGAAAAATGG - Intergenic
1188277957 X:28224337-28224359 CTGCTTTTGCAAAGTAAAAGAGG + Intergenic
1189897231 X:45668213-45668235 CTCCTTTCTTGAAGGAAAATAGG + Intergenic
1190457277 X:50638387-50638409 CTACTTTACTGAAGGAAAAGAGG - Intronic
1192406012 X:70887180-70887202 CTGCTTTTCTTAAGCAGAAGGGG - Intronic
1193088392 X:77468144-77468166 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1193151674 X:78131568-78131590 ATGCATTTCAAAAGGAAAGTTGG - Exonic
1193749917 X:85328547-85328569 GTGATTTTCCTAAGGAAAATTGG + Intronic
1193999609 X:88411606-88411628 CTCCTTTTTTAAAAAAAAATAGG + Intergenic
1194095751 X:89636744-89636766 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1194424484 X:93719681-93719703 CTGCTTTTCTAATGGAAGTAGGG + Intergenic
1194527349 X:94993467-94993489 CTGTTTTTTTAATGTAAAATAGG + Intergenic
1195916635 X:109942583-109942605 CTGCTTTTCTAAATTAATTTAGG + Intergenic
1196512097 X:116523840-116523862 CTGTTTTTCTCAAGCAAAAAGGG + Intergenic
1197283395 X:124565011-124565033 ATACTTTTCAAAAGGAAAAATGG + Intronic
1197729374 X:129796900-129796922 CTCCTTTTCTAAAATAAAAATGG - Intergenic
1199266255 X:145830773-145830795 GTGTTTTGCTAAAGGAGAATTGG + Intergenic
1200308264 X:155051121-155051143 CTGTTTTTATCAAGGGAAATAGG + Intronic
1200448751 Y:3298116-3298138 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic