ID: 1029107443

View in Genome Browser
Species Human (GRCh38)
Location 7:98189829-98189851
Sequence CACAGCTGCCAGCGTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029107437_1029107443 -2 Left 1029107437 7:98189808-98189830 CCCTCAGGGTCTCTCCTGGCACA 0: 1
1: 0
2: 2
3: 24
4: 311
Right 1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG No data
1029107433_1029107443 16 Left 1029107433 7:98189790-98189812 CCTGCTGTGGTGAGGCAGCCCTC 0: 1
1: 0
2: 1
3: 18
4: 326
Right 1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG No data
1029107438_1029107443 -3 Left 1029107438 7:98189809-98189831 CCTCAGGGTCTCTCCTGGCACAC 0: 1
1: 0
2: 4
3: 36
4: 381
Right 1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029107443 Original CRISPR CACAGCTGCCAGCGTGATGG GGG Intronic
No off target data available for this crispr