ID: 1029109807

View in Genome Browser
Species Human (GRCh38)
Location 7:98207231-98207253
Sequence ACGGGTCTGGAGAGCACCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029109807_1029109818 5 Left 1029109807 7:98207231-98207253 CCTGGGGTGCTCTCCAGACCCGT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1029109818 7:98207259-98207281 GGCCGCCTGGGGTACACGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
1029109807_1029109812 -8 Left 1029109807 7:98207231-98207253 CCTGGGGTGCTCTCCAGACCCGT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1029109812 7:98207246-98207268 AGACCCGTGCAGGGGCCGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 145
1029109807_1029109814 -6 Left 1029109807 7:98207231-98207253 CCTGGGGTGCTCTCCAGACCCGT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1029109814 7:98207248-98207270 ACCCGTGCAGGGGCCGCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1029109807_1029109817 1 Left 1029109807 7:98207231-98207253 CCTGGGGTGCTCTCCAGACCCGT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1029109817 7:98207255-98207277 CAGGGGCCGCCTGGGGTACACGG 0: 1
1: 0
2: 1
3: 27
4: 240
1029109807_1029109813 -7 Left 1029109807 7:98207231-98207253 CCTGGGGTGCTCTCCAGACCCGT 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1029109813 7:98207247-98207269 GACCCGTGCAGGGGCCGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029109807 Original CRISPR ACGGGTCTGGAGAGCACCCC AGG (reversed) Exonic
900146383 1:1160678-1160700 AGGGGTGTGGGGGGCACCCCAGG - Intergenic
900226378 1:1535255-1535277 GCGGGACTGGACAGCAGCCCTGG - Exonic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900720609 1:4173507-4173529 ACAGGTCTGGAGATCAGCCCAGG - Intergenic
902236868 1:15063342-15063364 ACTGGGCAGGAGAGGACCCCAGG + Intronic
903174267 1:21571283-21571305 ATGGGGCTGGAGACAACCCCTGG + Intronic
903892461 1:26578818-26578840 ACAGGTCGGGACAGCCCCCCAGG + Intergenic
907335816 1:53698709-53698731 GCAGGTCTGGAGGGCATCCCTGG - Intronic
910709839 1:90167714-90167736 ACAGGTCTGGAGTGGACCTCCGG + Intergenic
912562553 1:110561071-110561093 ACGGGGCTGGAGGGCACCCCAGG - Intergenic
912729341 1:112088320-112088342 ACAGCTCTGGACAGCACCCTGGG - Intergenic
918378332 1:183931237-183931259 ACGGAACTGGAGAGAATCCCTGG + Intronic
923506142 1:234608601-234608623 GCGGGTCTGGAGAGCAGGACTGG - Exonic
923531950 1:234818780-234818802 ATGTTCCTGGAGAGCACCCCTGG - Intergenic
924192262 1:241566286-241566308 AAGAAGCTGGAGAGCACCCCTGG + Intronic
1071789818 10:88941921-88941943 AATGGTCAGGAGAGCACACCTGG + Intronic
1074106204 10:110391644-110391666 ACCGGTCTGGAGAGGGCTCCAGG - Intergenic
1075095367 10:119467693-119467715 GCTGGTCTGAAGAGCACACCTGG - Intergenic
1075944927 10:126424543-126424565 ACGTGTCAGGAGAGAACCCCAGG + Intergenic
1077123930 11:924302-924324 ACTGTCCTGGAGAGCAGCCCAGG + Intergenic
1077152398 11:1078119-1078141 AGGGGACTGAAGAGCACGCCTGG - Intergenic
1077456515 11:2684708-2684730 AGGGGCCTGGAGAGAACCCAGGG + Intronic
1077855165 11:6116449-6116471 TAGGGTCTGGAGTGGACCCCTGG + Intergenic
1078830553 11:14973122-14973144 ATGGATCTGAAGAGTACCCCGGG - Intronic
1078933718 11:15934424-15934446 ACGTGTCTGGACAGCATCCAAGG - Intergenic
1083477832 11:62925566-62925588 CCGGGTCTGCAGCGCACTCCCGG - Intergenic
1083912814 11:65720097-65720119 TGGGGTCTGGAGACCATCCCTGG - Exonic
1083944804 11:65917897-65917919 ACTGGTCTGCAGAGCTTCCCAGG + Exonic
1086004859 11:82026372-82026394 AAGGGTGTGGGGAGCAGCCCTGG - Intergenic
1089604255 11:119632561-119632583 AGAAGTCTGGGGAGCACCCCTGG + Intronic
1092629437 12:10362695-10362717 AGAGGACTGGAGACCACCCCTGG - Intergenic
1096652984 12:53071220-53071242 CTGGGTCTGGGGAGGACCCCTGG + Intronic
1097074566 12:56383426-56383448 AGGGATCTGGGGAGAACCCCAGG - Intergenic
1105781633 13:23709733-23709755 AAGCCTCTGGAGGGCACCCCAGG + Intergenic
1106108558 13:26757224-26757246 AATGGTCTTGAGAGCACCCTGGG + Exonic
1107299117 13:38947107-38947129 ACAGGGATGGAGAGCATCCCAGG - Intergenic
1107491137 13:40880684-40880706 ACGGATCCTGAGAGCACTCCTGG - Intergenic
1110060721 13:71034414-71034436 ACGGGTGTGGTGGGCAGCCCAGG + Intergenic
1114713881 14:24804714-24804736 GCTGGACTGGAGACCACCCCGGG - Intergenic
1119527019 14:75330891-75330913 AGGGGTCTGTAGAACACCCAAGG + Intergenic
1121426508 14:93856133-93856155 GTGGGGCTGGAGGGCACCCCAGG + Intergenic
1122118710 14:99540636-99540658 ACGGGTTAGGGGAGCACCCCAGG - Intronic
1122701139 14:103589957-103589979 ACAGGGCTGGAGAGGACTCCAGG + Intronic
1124656383 15:31512334-31512356 GAGGGACTGGAGACCACCCCCGG + Intronic
1129609072 15:77038681-77038703 ACTGGGCTGGAGAGCAACTCTGG + Intergenic
1130729409 15:86474961-86474983 AAGGGTCTGGAGTGGACCTCCGG + Intronic
1130863007 15:87908176-87908198 ACAGGTCTGGACAGAAGCCCTGG + Intronic
1132145743 15:99428399-99428421 ACAGCTCTGGAGAGAACCCGGGG - Intergenic
1134620545 16:15685795-15685817 ACGTGTTTGGAGAGGAACCCAGG - Intronic
1135025571 16:18996707-18996729 AAGGGGGTGGAGAGCAGCCCTGG + Intronic
1137566926 16:49539167-49539189 ACGGCTCTGGACACCAGCCCTGG + Intronic
1138532371 16:57641390-57641412 ACGTGGCTGCAGACCACCCCAGG + Intronic
1140182606 16:72735841-72735863 AAGGGTCTGGAGTGGACCCTAGG - Intergenic
1141082067 16:81061403-81061425 TGGGGTCTGGAGGGCACGCCAGG + Exonic
1141682346 16:85551972-85551994 AGGGGCTTGGAGAGCTCCCCAGG - Intergenic
1142333816 16:89473709-89473731 AGGGTTCTGAAGAACACCCCAGG + Intronic
1144231107 17:13204801-13204823 GTGGGTCTGGAGAGCAACCTGGG + Intergenic
1144927489 17:18824758-18824780 ACAGGTCTGGGCAGCACACCTGG - Intergenic
1145012756 17:19378935-19378957 ACGGCTCTGCGGAGCCCCCCGGG + Exonic
1146175528 17:30663849-30663871 ACGGGGCTGCAGAGATCCCCGGG - Intergenic
1146453991 17:32995405-32995427 ACAGGGCTTGAGTGCACCCCTGG - Exonic
1147606686 17:41777662-41777684 TCCAGTCTGGAGAGCAGCCCAGG + Intronic
1147931105 17:43982108-43982130 AGGGCTCTGGAGAGCTCCCCTGG - Intronic
1150652654 17:67019996-67020018 CAAGGGCTGGAGAGCACCCCGGG + Intronic
1152685265 17:81690754-81690776 CCGGGGCTGTAGAGCCCCCCAGG - Intronic
1152921216 17:83067483-83067505 GCGGGTCCCGAGAGAACCCCAGG - Intergenic
1157016403 18:43719939-43719961 GAGGGTCTGGAGTGGACCCCTGG + Intergenic
1159102437 18:63971016-63971038 AGGGGCCCGGAGAGCAGCCCTGG - Intronic
1160118126 18:76100800-76100822 ACCTGTCTGCAGAGCACCCATGG - Intergenic
1160726141 19:618651-618673 GGGGGTCTGGAGAGCAGCCACGG - Intronic
1160951946 19:1672033-1672055 AGGGGTCTGGGGAGGACCCCGGG - Intergenic
1163846174 19:19639409-19639431 GCAGGTCTGGAGAAGACCCCAGG - Intronic
1168399889 19:56079574-56079596 ACGGGGCTGGAGAGAGCACCAGG - Intergenic
925387634 2:3473195-3473217 AGGGGAAAGGAGAGCACCCCTGG + Intronic
926044560 2:9700376-9700398 GCAGGTCTGGAGAGGAACCCAGG - Intergenic
927667505 2:25042512-25042534 CCGGGCCTGGAGAGGACCCCAGG - Intronic
936074389 2:109392484-109392506 AGGGGCCTGGTGACCACCCCTGG - Intronic
936112780 2:109678410-109678432 AGGGGTGTGGGGAGCACCCCAGG - Intergenic
937052763 2:118905827-118905849 AGGGCTGGGGAGAGCACCCCGGG + Intergenic
1168807585 20:681503-681525 CCGGGTCTGGACAGCAGCTCAGG - Intergenic
1170484449 20:16802411-16802433 TCCAGGCTGGAGAGCACCCCTGG + Intergenic
1170736937 20:19020998-19021020 ACAGGTCTAGAGTGCAGCCCAGG - Intergenic
1172094060 20:32452167-32452189 CTGGGTCTGCAGAGCAGCCCTGG - Intronic
1172619909 20:36312001-36312023 TCTGGTCTGGAGAGCAGCCTTGG + Intronic
1173969554 20:47141412-47141434 ATTGGTCTGGAGAGCAGCCTGGG + Intronic
1175551637 20:59821791-59821813 ATGGGCTTGGAGAGCACCGCCGG + Intronic
1176065354 20:63191398-63191420 GCAGGTCTGGTGGGCACCCCTGG + Intergenic
1179314658 21:40231949-40231971 ACTGGTCTGGACACCACCCTTGG + Intronic
1179541484 21:42085843-42085865 CCAGGGCTGGAGAGCACCCTGGG + Intronic
1179559224 21:42202183-42202205 AGGGGTCTGGAGTGGAACCCTGG - Intronic
1184199462 22:42956657-42956679 TCTGGTCTGGAGAGCTGCCCTGG + Intronic
1184405436 22:44298148-44298170 GGGGGCCTGGAGAGCTCCCCTGG - Intronic
1184886672 22:47350774-47350796 AAGGGTCTGGAGTGGACCTCCGG - Intergenic
1185140559 22:49098585-49098607 ATGGGCCCGGAGGGCACCCCTGG - Intergenic
949933843 3:9101434-9101456 ACGGGTCACGTGAGCACACCGGG - Intronic
951741786 3:25932343-25932365 CAGGGTCTGGAGTGGACCCCTGG + Intergenic
951904174 3:27688003-27688025 TGGGGTATGGAGAGCACCTCTGG + Intergenic
953869597 3:46615119-46615141 ACGGGTCTGGAGTGAACATCTGG + Intronic
968229370 3:196996279-196996301 ACGGGTCTGCAGAGATCCCCTGG + Intronic
969022727 4:4148556-4148578 ACAGGGGTGGTGAGCACCCCCGG + Intergenic
969991971 4:11274173-11274195 GATGGTCTGGAGAGCACCTCTGG + Intergenic
971658912 4:29386757-29386779 ATGGAACTGGTGAGCACCCCAGG - Intergenic
973569606 4:52224620-52224642 CAGGGTCTGGAGTGCACCTCTGG - Intergenic
982909125 4:161117529-161117551 AAGGGTCTGGAGTGTACCTCTGG - Intergenic
984476626 4:180243547-180243569 AGGGATCTGGTGAGCTCCCCAGG - Intergenic
986168150 5:5293504-5293526 AGCTGGCTGGAGAGCACCCCAGG + Intronic
986484440 5:8220868-8220890 CAGGGTCTGGAGTGGACCCCAGG + Intergenic
986777296 5:11028218-11028240 GCTGGACTGGAGAGCAACCCCGG + Intronic
995045641 5:107643482-107643504 TTGTGTCTGGAGAGCACCCCAGG - Intronic
996717674 5:126600911-126600933 GCGGGTCAGGAGAGCACTTCCGG - Exonic
997614393 5:135236626-135236648 ACGTGTCAGGAGTTCACCCCTGG - Intronic
1000236540 5:159366761-159366783 ACGGATCCTGAGAGCACCCCTGG + Intergenic
1003608564 6:7587978-7588000 AGGAGTCTGGAGACCACTCCAGG + Intergenic
1006846881 6:37068575-37068597 ACGGGACTGGGGAGCACACACGG + Intergenic
1007729725 6:43938667-43938689 AAGGGCCTGGAGAGGCCCCCGGG - Intergenic
1012233271 6:96784857-96784879 ACGTGTCTGGAAAGCCTCCCTGG + Intergenic
1012878122 6:104753613-104753635 TGGGGTCTGGAGAGGACCCCTGG + Intronic
1013366321 6:109440818-109440840 GGGGGTCCGGAGAGCGCCCCCGG - Exonic
1013908971 6:115250960-115250982 AAGGGTCTGGAGTGGACCTCTGG + Intergenic
1014115507 6:117664242-117664264 AGGGGGGTGGAGAGCAGCCCTGG + Intergenic
1018910554 6:168098821-168098843 AGGGGACGGGAGAGCAGCCCAGG + Intergenic
1019559990 7:1651142-1651164 AAGGCTCGGGAGGGCACCCCAGG + Intergenic
1021840047 7:24714853-24714875 AAGGGTCCGCAGAGCACTCCTGG + Intronic
1023086096 7:36571407-36571429 AAGGGGCTGGAGAGCAGCCTTGG - Intronic
1023881481 7:44323963-44323985 GTGGATCTGGAGAGCACCACAGG - Intronic
1023882178 7:44326645-44326667 CCGGTTCTGGACAGCAGCCCTGG - Intronic
1026254610 7:68699670-68699692 ATGGATCTGGAGAGCAGCCTAGG - Intergenic
1027353804 7:77337511-77337533 AAGTCTCTGGAGAGCAGCCCAGG + Intronic
1029109807 7:98207231-98207253 ACGGGTCTGGAGAGCACCCCAGG - Exonic
1031207348 7:118777453-118777475 AGGGATCTGGAGAACAGCCCAGG - Intergenic
1032357368 7:131223291-131223313 ACTGGTCTGGAGACAAGCCCAGG + Intronic
1032406459 7:131659471-131659493 ACTGGTCTGGAGTGCAGCCTGGG - Intergenic
1035253839 7:157613807-157613829 AGGGGTCCCGAGGGCACCCCGGG + Intronic
1035619851 8:1028648-1028670 ACGGGGCTGGAGAGCCATCCAGG + Intergenic
1038452733 8:27650329-27650351 ATGGGTCTCGGGAGGACCCCAGG - Intronic
1040482221 8:47836432-47836454 ACGGGTCTGGAGAGTGCCCTGGG + Exonic
1040993672 8:53379175-53379197 ACGGATCCTGAGAGCACTCCTGG - Intergenic
1042967046 8:74364782-74364804 AGTGGGCTGGAGAGAACCCCAGG + Exonic
1043551367 8:81376751-81376773 TTGGGTCTGGAGTGCACCTCAGG - Intergenic
1049756829 8:144314462-144314484 TCGGGTCTGGGCAGCACCTCTGG + Exonic
1057753412 9:97810290-97810312 AGGGGTCTGGAGGTCCCCCCTGG + Intergenic
1060873456 9:127061635-127061657 ATGGGGCTGGAGAGGACCCGAGG - Intronic
1061275143 9:129565834-129565856 CCAGGTCTGAAGAGCACACCTGG - Intergenic
1061590825 9:131596537-131596559 GTGAGTCTGGAGGGCACCCCTGG - Intronic
1062318606 9:135979792-135979814 CTGGGTCTGCAGACCACCCCAGG + Intergenic
1062550853 9:137085955-137085977 GCGTGTCTGGAGAGCTCCCCCGG - Intergenic
1191638952 X:63409622-63409644 ACGGATCTTGAGAGCACTCCCGG + Intergenic
1196247457 X:113416131-113416153 ATGGCTCTGGACAGCACCTCTGG + Intergenic
1201062429 Y:10059287-10059309 AGGAGGCTGGGGAGCACCCCAGG + Intergenic