ID: 1029110874

View in Genome Browser
Species Human (GRCh38)
Location 7:98212447-98212469
Sequence CCGGAGCCCTTGCTGCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029110874_1029110886 12 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110886 7:98212482-98212504 GCAGGCGGCCAGGACCCTCCGGG 0: 1
1: 1
2: 2
3: 28
4: 246
1029110874_1029110881 -6 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110881 7:98212464-98212486 CTCCGGGCGAGGGCAGGCGCAGG 0: 1
1: 0
2: 3
3: 36
4: 243
1029110874_1029110887 17 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110887 7:98212487-98212509 CGGCCAGGACCCTCCGGGCCCGG 0: 1
1: 0
2: 2
3: 28
4: 374
1029110874_1029110884 2 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110884 7:98212472-98212494 GAGGGCAGGCGCAGGCGGCCAGG 0: 1
1: 0
2: 3
3: 48
4: 546
1029110874_1029110883 -3 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110883 7:98212467-98212489 CGGGCGAGGGCAGGCGCAGGCGG 0: 1
1: 0
2: 1
3: 60
4: 467
1029110874_1029110889 20 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110889 7:98212490-98212512 CCAGGACCCTCCGGGCCCGGTGG 0: 1
1: 0
2: 1
3: 20
4: 306
1029110874_1029110885 11 Left 1029110874 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1029110885 7:98212481-98212503 CGCAGGCGGCCAGGACCCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029110874 Original CRISPR CCGGAGCCCTTGCTGCGGCC CGG (reversed) Exonic