ID: 1029111426

View in Genome Browser
Species Human (GRCh38)
Location 7:98214734-98214756
Sequence CAGGAAGCCCTGGGCTGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 12, 3: 53, 4: 427}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029111426_1029111437 -1 Left 1029111426 7:98214734-98214756 CCAGCGCAGCCCAGGGCTTCCTG 0: 1
1: 0
2: 12
3: 53
4: 427
Right 1029111437 7:98214756-98214778 GGGGGGCAGCAGGAGTGCCTGGG 0: 1
1: 0
2: 2
3: 49
4: 473
1029111426_1029111438 0 Left 1029111426 7:98214734-98214756 CCAGCGCAGCCCAGGGCTTCCTG 0: 1
1: 0
2: 12
3: 53
4: 427
Right 1029111438 7:98214757-98214779 GGGGGCAGCAGGAGTGCCTGGGG 0: 1
1: 0
2: 2
3: 91
4: 881
1029111426_1029111442 22 Left 1029111426 7:98214734-98214756 CCAGCGCAGCCCAGGGCTTCCTG 0: 1
1: 0
2: 12
3: 53
4: 427
Right 1029111442 7:98214779-98214801 GGTCACCGCCTTCAGGACAATGG 0: 1
1: 0
2: 0
3: 9
4: 115
1029111426_1029111439 1 Left 1029111426 7:98214734-98214756 CCAGCGCAGCCCAGGGCTTCCTG 0: 1
1: 0
2: 12
3: 53
4: 427
Right 1029111439 7:98214758-98214780 GGGGCAGCAGGAGTGCCTGGGGG 0: 1
1: 0
2: 5
3: 68
4: 1372
1029111426_1029111440 15 Left 1029111426 7:98214734-98214756 CCAGCGCAGCCCAGGGCTTCCTG 0: 1
1: 0
2: 12
3: 53
4: 427
Right 1029111440 7:98214772-98214794 GCCTGGGGGTCACCGCCTTCAGG 0: 1
1: 0
2: 12
3: 59
4: 204
1029111426_1029111436 -2 Left 1029111426 7:98214734-98214756 CCAGCGCAGCCCAGGGCTTCCTG 0: 1
1: 0
2: 12
3: 53
4: 427
Right 1029111436 7:98214755-98214777 TGGGGGGCAGCAGGAGTGCCTGG 0: 1
1: 0
2: 3
3: 60
4: 1215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029111426 Original CRISPR CAGGAAGCCCTGGGCTGCGC TGG (reversed) Exonic
900299358 1:1969277-1969299 TGGGAAGGCCTGGGCTGGGCAGG - Intronic
900335373 1:2160562-2160584 CAAGAGGCCCTGGGATGCGGAGG + Intronic
900566473 1:3334631-3334653 TAGGAAGCCCTGGGCTGGGCTGG - Intronic
901069895 1:6511859-6511881 CAGGAAGCCCAGGGCCGGGCAGG + Intronic
901419656 1:9142453-9142475 CAGGAAGCCCTGGGCAGGTTAGG + Intergenic
901679202 1:10903522-10903544 CAGGAAGCTCTGGGCTGCTGGGG + Intergenic
901702534 1:11053333-11053355 CAGGAGACCCTGGGGTGAGCAGG + Intergenic
902609220 1:17587559-17587581 GGGGACGCCCAGGGCTGCGCTGG - Exonic
902891300 1:19445909-19445931 CAGGGAGTGCTGGGCTGTGCAGG + Intronic
902955929 1:19924047-19924069 CAGGAGGCCCTGGCCTGGCCTGG + Intergenic
903660029 1:24971380-24971402 CAGGCAGCCCTTGGCTGGGTCGG - Intergenic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
904725075 1:32540553-32540575 CAGGAGGCCCTGGGCGGCTATGG - Intronic
904855703 1:33496826-33496848 CAGAAAGCCCTGGGCAGGCCTGG - Intergenic
905146151 1:35888281-35888303 CTGGAAGCCCTTGGCTGGGTTGG + Intronic
905172096 1:36115382-36115404 CAGGAGGGGCTGGGCTGGGCAGG + Intronic
905694033 1:39961926-39961948 TAGAAAGCCCTGGGCTGGGAAGG - Intronic
906306802 1:44724748-44724770 CACGAAGCACTGCGCCGCGCGGG - Exonic
909873749 1:80778374-80778396 CAGGAAGGCCTGGGATGACCAGG - Intergenic
911146015 1:94553316-94553338 CAGGAAACCCTAGGATGCGGTGG + Intergenic
912499714 1:110113815-110113837 CAGGGAGCCTTGGGCAGCGCTGG - Exonic
913200710 1:116493638-116493660 CACAGAGCCCTGGGCTGAGCTGG - Intergenic
913469039 1:119171802-119171824 CAGGGAGGCTTGGGCCGCGCAGG - Intergenic
914337683 1:146730470-146730492 CATGAAGCGCTGGGGTGCACTGG - Intergenic
915465583 1:156096006-156096028 CAGGGAGCCCTGGGCAGTGTGGG - Intronic
915997188 1:160575306-160575328 GAGGAAGCACAGGGCTGGGCAGG + Intronic
916727398 1:167535204-167535226 AAGGGAGCCCTGGGCTGTGGGGG - Intronic
916787025 1:168093804-168093826 CAGAAAGCCATGGACAGCGCAGG + Intronic
918064405 1:181089550-181089572 CAGGAAGCGCTGCGCGGCGGGGG + Exonic
918135885 1:181673667-181673689 ATGGAAGCCATGGGCTGGGCAGG + Intronic
918437737 1:184533780-184533802 CAGGAGGCCCTGGCCGGGGCTGG + Intronic
919465947 1:197921681-197921703 CAGGGAGGCCGGGGCTGCGCCGG - Intronic
919902858 1:202056954-202056976 CAGGAGGCCCAGGGCTGGGTAGG - Intergenic
920001996 1:202807239-202807261 CGGGGAGGCCTGGGCTGTGCTGG - Intronic
920284148 1:204867828-204867850 CAGGCAGCCATGGGCTGAGTCGG - Intronic
920555331 1:206900132-206900154 CAGGAAGGACTGGGCTGAGCTGG - Intronic
920920722 1:210295239-210295261 CAGGAAGTCCCCGGCTGGGCTGG + Intergenic
921053661 1:211528170-211528192 CTGGAGGCCCTGGCCTGCCCTGG - Intergenic
922246341 1:223802084-223802106 CAGGAAGAACTAGGCTGTGCAGG + Intronic
923772255 1:236947954-236947976 CAGGAGGCCCTGTGGGGCGCAGG + Intergenic
924090845 1:240499300-240499322 AAGTTAGCCCTGGGCTGTGCAGG + Intronic
924633378 1:245763053-245763075 CAGAGAGCCCTGGGCTCCTCCGG + Intronic
1063610093 10:7554418-7554440 AAGAAAGGCCTGGGATGCGCAGG + Intergenic
1064028754 10:11869831-11869853 CGGGGTGCCTTGGGCTGCGCCGG - Exonic
1065189367 10:23196170-23196192 CAGGGAGGCCCGAGCTGCGCTGG + Intergenic
1070172769 10:73944900-73944922 CAGGGAGGCTTGGGCTGCCCAGG - Intergenic
1070655385 10:78267621-78267643 CTGGGAGCCCTGGGCTGGGGTGG + Intergenic
1071568616 10:86684432-86684454 CAGGGGGCCCTGGGCTGGTCAGG + Intronic
1071574810 10:86717161-86717183 CAGACAGGCCTGGGCTGCTCAGG + Intronic
1073998102 10:109339257-109339279 CAGTAGGCCCTGAGCTGCGCTGG + Intergenic
1074323184 10:112422382-112422404 CAGGAAGCCCTGGACAGTGATGG + Exonic
1075673500 10:124280413-124280435 CAGGAAGGGCAGGGCTGGGCTGG + Intergenic
1075716720 10:124559892-124559914 CAGGGAGCACTTGGCAGCGCTGG - Intronic
1076624429 10:131812805-131812827 CAGGCAGCCCTGGGCGCCTCTGG + Intergenic
1076726372 10:132416069-132416091 GTGGAAGCCCTGGGCTGCCATGG - Intronic
1076734965 10:132454719-132454741 CGGGACGCCCAGGGCTGCTCTGG - Intergenic
1076992513 11:282843-282865 CAGGATGCCCTGGGCAGAGACGG + Intronic
1077077637 11:708661-708683 CAGGAAACCCTGGGGTCCCCGGG - Intronic
1077123979 11:924507-924529 CAGGAAGCCCTCTGCTGGGTCGG + Intergenic
1077164020 11:1127029-1127051 GAGGGAGCCCTGGCCTGCGCTGG + Intergenic
1077295675 11:1825307-1825329 CAGGAAAGCCTGGGCTGCACGGG - Intergenic
1077302894 11:1855304-1855326 CAGGAAGGCCCAGGCTGGGCAGG + Intronic
1077760888 11:5096286-5096308 CAGTAAGCCCAGTGCTGGGCAGG + Intergenic
1080105982 11:28512396-28512418 CAGGGAGGCTTGGGCTGCACAGG + Intergenic
1080853711 11:36093599-36093621 CAGTAAGGCCTGGGCGGGGCAGG - Intronic
1081967819 11:47180135-47180157 CAGGAAGCCGTGCCCTGGGCGGG + Intronic
1083203238 11:61132395-61132417 GAGGAAGCCCAGGGCTTCCCAGG - Exonic
1083304733 11:61756412-61756434 CAGGAATCCGGGGGCTGAGCTGG + Intronic
1083804154 11:65063870-65063892 CAGGAACCTCTGGGCTGGGCTGG + Intergenic
1083949427 11:65945873-65945895 CAGGGAGGCCTGGGCTGGGGAGG + Intronic
1084313853 11:68332399-68332421 CAGGCAGCCCTGCTCTGCACCGG + Intronic
1084314483 11:68337115-68337137 CAGAAACACCTGGGCTGCCCTGG - Intronic
1088849635 11:113694543-113694565 CCGGAAGCCCAGGGCCACGCTGG + Exonic
1089316322 11:117593577-117593599 CAGGAAAGACTGGGCTGGGCAGG + Intronic
1089679128 11:120109759-120109781 CAGGAGGCCCAGGGCTGTGCTGG - Intergenic
1089792269 11:120953641-120953663 CAGGAAACCAGGGGCTGCCCTGG + Intronic
1090128427 11:124114953-124114975 CAGGAAGACTTGGGCTTCCCTGG + Intergenic
1090746614 11:129710574-129710596 CAGGGAGCCCTGGGCTGTGGTGG + Intergenic
1091298572 11:134490219-134490241 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298583 11:134490260-134490282 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298594 11:134490301-134490323 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298605 11:134490342-134490364 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091544778 12:1494288-1494310 CTGCCAGCCCTGGGCTGCTCAGG + Exonic
1091752625 12:3032334-3032356 CTGGAAGCCGAGGGCCGCGCTGG - Intronic
1091771995 12:3158147-3158169 CAGGAAGCCCTGTGCTCCGAGGG - Intronic
1091831389 12:3553230-3553252 CTGGAAGGGCTGGGCTGCGGTGG + Intronic
1092127982 12:6088573-6088595 CAGGAAGCCCAAGGCTCCGGGGG - Intronic
1092230294 12:6772434-6772456 CCGTAAGCCCTGGGGTGCGGGGG + Intergenic
1096121872 12:49093855-49093877 CAGGAAGGGCTGGGGTGAGCTGG - Intronic
1096608779 12:52787538-52787560 CAGGAAGGCCAGGCCTGCTCTGG + Intergenic
1098277034 12:68823034-68823056 AAGGAAGCCCTAGGCTGGGTGGG - Intronic
1098385298 12:69912116-69912138 CTTGCAGCCCTGGGCTGAGCAGG - Intronic
1102111783 12:110370780-110370802 CGGGAAGCCCTGCGCTGGGAGGG - Intergenic
1102957694 12:117070108-117070130 CAACAGGCCCTGGGCTGTGCTGG - Intronic
1103411120 12:120711724-120711746 CAGGCAGCCCAGGGCTGTTCAGG + Intronic
1104768931 12:131348280-131348302 CAGGAGGCCGTGGGCAGGGCTGG + Intergenic
1104810822 12:131619368-131619390 CAGGAGGCCGTGGGCAGGGCTGG - Intergenic
1105697191 13:22900512-22900534 CAGGAAGGCTGGGGCTGGGCAGG + Intergenic
1106546733 13:30737337-30737359 GAGAAAGCCCTGGGCAGAGCAGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107437676 13:40394648-40394670 CAGCAGGCACTGGGCTGGGCTGG - Intergenic
1108845716 13:54676867-54676889 CAGGGAGGCTTGGGCTGTGCAGG - Intergenic
1113345399 13:109472758-109472780 CAGGCAGCCTTGTGCTGTGCTGG + Intergenic
1113375790 13:109764632-109764654 CAGGCAGCCCTGTGCTGCCAGGG + Intronic
1113461556 13:110485688-110485710 CAGGAATCCCTGGGCTGCCTGGG + Exonic
1113710157 13:112457776-112457798 CCGGAAGCTCTGGGCGGGGCCGG + Intergenic
1113715947 13:112508047-112508069 CAGGCAGCACTGGGATGGGCTGG - Intronic
1113742226 13:112719140-112719162 CAGGATGCCCTGTGACGCGCAGG + Intronic
1113742237 13:112719214-112719236 CAGGATGCCCTGTGACGCGCAGG + Intronic
1113750236 13:112771917-112771939 CCGGGAGCCCTGGGCTGGGCGGG + Intronic
1113906868 13:113823346-113823368 CAGGACGCCCTGGGTGGCGGAGG + Intronic
1113923583 13:113928323-113928345 CAGGAGGGGCGGGGCTGCGCAGG + Intergenic
1113927245 13:113948429-113948451 CAGGAGGCCCTGGGCTGAGGCGG + Intergenic
1114771361 14:25431072-25431094 CAGGGCTCCCTGGGCTGCTCTGG - Intergenic
1115646420 14:35371392-35371414 CAGGAAGCTGTGTGCTGTGCAGG - Intergenic
1118600831 14:67470550-67470572 TATGAAGCCCTGGGCTGTGTAGG - Exonic
1121633794 14:95440087-95440109 CAGGATGCCCTGGGCTCCCCGGG - Intronic
1121885673 14:97540529-97540551 GAGGAAGTCCTGGGTTTCGCAGG - Intergenic
1121996774 14:98608773-98608795 GATGAACCCCTGAGCTGCGCTGG + Intergenic
1122228483 14:100293116-100293138 CAGGAGCCCCTGGGGTGGGCTGG - Intronic
1122229289 14:100297557-100297579 CAGGCTGTCCTGGGCTGCTCTGG + Intronic
1122268549 14:100557985-100558007 CAGGCAGCCCTCAGCTGGGCTGG + Intronic
1122514573 14:102297986-102298008 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
1122858646 14:104572234-104572256 CCCGAAGCCCTGGGCTGAGTGGG + Intronic
1122904162 14:104794433-104794455 CAGGCAGCCCTGTGCTGGCCTGG - Intronic
1123036389 14:105473682-105473704 CAGGAAGCCCGTGGGTGCGGAGG + Intronic
1123063144 14:105603428-105603450 TTGGAAGACCTGGGCTGAGCTGG - Intergenic
1123668474 15:22629176-22629198 CAGGAAGACCTGGACTGAGAAGG + Intergenic
1123707290 15:22959541-22959563 CAGGAGGCCATGGGCTCGGCTGG + Intronic
1123783342 15:23646757-23646779 CAAGAAGCCATCGGCTGTGCAGG + Exonic
1124092628 15:26620734-26620756 GAGGAGGCCCTGGGCTTCCCTGG - Intronic
1124524453 15:30435637-30435659 CAGGAAGACCTGGACTGAGAAGG + Intergenic
1124534211 15:30530586-30530608 CAGGAAGACCTGGACTGAGAAGG - Intergenic
1124764437 15:32477025-32477047 CAGGAAGACCTGGACTGAGAAGG + Intergenic
1124774197 15:32572073-32572095 CAGGAAGACCTGGACTGAGAAGG - Intergenic
1125899246 15:43329963-43329985 GAGGAGGCCCTGGGCGCCGCGGG - Exonic
1128456769 15:67835574-67835596 CCGGGAGCCCTGGGCTGAGGGGG + Intergenic
1128907197 15:71477713-71477735 GAGGAAGATCTGGGCTGCACTGG - Intronic
1129748959 15:78046870-78046892 CAGGCATTCCTGTGCTGCGCAGG + Intronic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1130336449 15:82960941-82960963 CACAAAGCCCTGGCCTGTGCTGG + Intronic
1130383583 15:83392612-83392634 CAGGAGACCCTGGGCTCTGCAGG + Intergenic
1131284223 15:91044007-91044029 CGGGAAGTCCTGGGCAGCGCAGG + Intergenic
1132155803 15:99494740-99494762 CAGGGAGGCTTGGGCTGCCCAGG + Intergenic
1132201216 15:99956033-99956055 CAGGAAGCACAGGACTGGGCGGG + Intergenic
1132305346 15:100807898-100807920 CAGGCAGCCATGGGCTGGCCTGG - Intergenic
1132324744 15:100959327-100959349 CGGGCAGCCCTGGGCAGAGCAGG + Intronic
1132391373 15:101441029-101441051 CAGGAAGGCCTGGGATGCCCAGG + Intronic
1132592871 16:733965-733987 CAGGAGGCCCTGGGCAGTCCGGG - Intronic
1132693087 16:1190425-1190447 CGGGCAGCTCTGGGCTGAGCAGG - Intronic
1133224570 16:4334787-4334809 CTGGAAGTCCTGGGGTGCGAGGG - Exonic
1134042145 16:11076842-11076864 CAGCAGGCCCTGGGGTGGGCTGG - Intronic
1135179505 16:20260621-20260643 CAGGAAGCCCGAGGCTGCCCAGG - Intergenic
1136403836 16:30031955-30031977 CAGGGAGCCCTAGGATGCCCAGG + Intronic
1136548074 16:30966407-30966429 CGGGGAGCCCTGGGCTTTGCAGG + Intronic
1136990958 16:35151145-35151167 GAGGAAGCACAGGGCTGGGCAGG + Intergenic
1137328982 16:47471298-47471320 GAGGAAGGCCTGGGATGGGCAGG + Intronic
1137494165 16:48956838-48956860 CAGGTAGCACTAGGCTGAGCAGG - Intergenic
1138240210 16:55421407-55421429 CAGGAAGATCTGGGCCGCGTGGG + Intronic
1138893990 16:61180799-61180821 AAGGAAGCCCTGGACTGTGAAGG - Intergenic
1139354597 16:66360079-66360101 CAGGAAGCCCTGGCTTCCGCTGG + Intergenic
1139545649 16:67648395-67648417 CAGGAAGTCCCGCGCCGCGCCGG + Exonic
1139613478 16:68075188-68075210 CAGTAATCCCAGGGCTGGGCAGG + Intronic
1139996598 16:70986858-70986880 CATGAAGCGCTGGGGTGCACTGG + Intronic
1141784423 16:86189139-86189161 CAGGCTGCCCGGGGCTGCGGTGG + Intergenic
1141982581 16:87559690-87559712 CAGGATGCCCTGCGGTGCACAGG - Intergenic
1142164837 16:88580708-88580730 CTGGGAGCCCTGGGGTGCGCCGG + Intronic
1142347597 16:89563979-89564001 CAGGGTGCCCTGGTCTGAGCTGG + Exonic
1142356380 16:89603845-89603867 GGGGAAGCCCTGGGCTGCAGAGG + Intergenic
1142496525 17:309312-309334 CAGGAAGCCATGGACAGAGCAGG - Intronic
1142694323 17:1625048-1625070 CAGGAAGCCCCGTGCTTCTCGGG + Intronic
1142762544 17:2050605-2050627 CGGGAAGCCGTGGGCGCCGCGGG + Intergenic
1142780553 17:2178189-2178211 CAAGAGGCCCTGGGCTGGGCTGG + Intronic
1143096406 17:4480762-4480784 CAGGGAGCCCTGAGGTGGGCTGG - Intronic
1143461458 17:7107059-7107081 CGGGAAGGCCTGGGCTGAGGCGG - Exonic
1144584651 17:16480907-16480929 CAGGGACCACTGGGCTGGGCAGG + Intronic
1144680125 17:17187643-17187665 CAGGGAGCCTTGTGCTGCACAGG + Exonic
1144948817 17:18983163-18983185 CCAGTAGCCCTGGGCTGGGCCGG + Intronic
1145250696 17:21295503-21295525 CAGGCAGCCCAGGGCTGCCCAGG - Intronic
1146124340 17:30220085-30220107 CAGGAAGCGCTGAGCTTCCCAGG + Intronic
1146401078 17:32500500-32500522 CAGGCAGGCCAGGGCTGCCCAGG - Intronic
1146833269 17:36088850-36088872 GAGCAAGCCCTGAGCTGCCCAGG - Intronic
1147265557 17:39232262-39232284 CCTGAACCCCTGGGCTGCCCCGG - Intergenic
1147469584 17:40647452-40647474 CAGGAAGCCGTGGGCAAGGCAGG - Intronic
1147564308 17:41527366-41527388 CAGGAGGCCCTACGCTGCGGTGG + Intronic
1147971384 17:44220326-44220348 CTGGAAGCCCTAGTCTGAGCTGG - Intronic
1147987623 17:44315438-44315460 CAGGTAGCCCTGCGGGGCGCCGG - Exonic
1148871443 17:50660851-50660873 CAGGAAGCCAAGGGCTAGGCTGG - Intronic
1149498958 17:57136748-57136770 CAGGAGACCCAGGGCTGAGCAGG + Intergenic
1150214401 17:63458648-63458670 CGTGAAGCCCTGGGCTACTCTGG - Intergenic
1151309069 17:73282451-73282473 AAGGGAGCCCTGGTCTGCGTAGG - Intergenic
1151563068 17:74881122-74881144 CATGCAGCCCAGGGCTGAGCTGG + Exonic
1151713879 17:75821735-75821757 TCGGAAGCCCGGGGCTGCCCTGG + Intronic
1151717199 17:75836929-75836951 CAGGAAGCCCTCAGCTGGACAGG + Intronic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1151940460 17:77288472-77288494 CAGGAAGGGCTGGGCAGAGCAGG + Intronic
1152278385 17:79371359-79371381 ACGGAAGCCCTGGGCTCCTCTGG - Intronic
1152546770 17:81004193-81004215 CGGGAAGGGCTGGGCTGGGCTGG - Intronic
1154412304 18:14148090-14148112 CTGGGAGCCCTGGGCTGGGCAGG - Intergenic
1154942931 18:21132599-21132621 CAGGGAGGCTCGGGCTGCGCAGG + Intergenic
1155166781 18:23238073-23238095 GAGGAAGCGCTCGGCTGTGCCGG - Intronic
1157575525 18:48740633-48740655 CAGGATGTCCTGGGCTACTCAGG + Intronic
1160027311 18:75229083-75229105 CAGTCAGCCCTGGGCGGGGCAGG + Intronic
1160266618 18:77344162-77344184 CAGGAAGCTGGGGGCTGTGCTGG - Intergenic
1160503954 18:79417075-79417097 CAGGAAGCCCTCAGCTGTGGTGG + Intronic
1160793645 19:934125-934147 CAGGGAGCCCTGGGCTGGAGGGG + Intronic
1160950735 19:1666011-1666033 CAGGGAGACCTGGGCTGAGACGG + Intergenic
1160971174 19:1768431-1768453 CAGGAAGGACTGGCCTGCACCGG + Intronic
1161001936 19:1914934-1914956 CAGGGAACCCTGAGCTGCCCTGG - Intronic
1161074895 19:2280814-2280836 CAGGGAGCCCTGGGCTGCGGGGG - Intronic
1161864693 19:6825342-6825364 AAGGAAGCCCTGGGCACCCCTGG + Exonic
1162321563 19:9973791-9973813 CAGGCAGCCCTGGAGTGCCCTGG + Exonic
1162421001 19:10566032-10566054 GAGGAAGCCCTGGACGGGGCGGG + Intronic
1163170158 19:15525570-15525592 CAGGCAGGACTGGGCTGGGCTGG + Intronic
1163611885 19:18305957-18305979 CTGGAAGCCTTGGGATGCACCGG - Intergenic
1164614164 19:29656149-29656171 CAGGGAGCCGGGGGCTGTGCAGG + Intergenic
1165108887 19:33489750-33489772 CAGGCAGCCCTGGCCAGGGCAGG - Intronic
1165867798 19:38949734-38949756 CAGGAAGACCCTGGCTGGGCCGG - Intronic
1166379009 19:42344754-42344776 CAGGAAGCTCTGGGTGACGCAGG - Exonic
1166882921 19:45940157-45940179 CAGGAAGCCCCCGGCCGCCCCGG + Exonic
1167148557 19:47696262-47696284 GGGGAAGACCTGGGCTGGGCTGG - Intronic
1168230276 19:55026972-55026994 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230296 19:55027026-55027048 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230316 19:55027080-55027102 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230336 19:55027134-55027156 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230356 19:55027188-55027210 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230376 19:55027242-55027264 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230394 19:55027296-55027318 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230411 19:55027350-55027372 CAGGAAGCCCTGGGCTGTAGGGG - Intronic
1168230431 19:55027404-55027426 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168230451 19:55027458-55027480 CAGGAAGCCCTGGGCTGCAGGGG - Intronic
1168271060 19:55250051-55250073 CAGGCAGCCACGGGCTGTGCAGG - Intronic
1168452645 19:56477928-56477950 GAAGAAGGCTTGGGCTGCGCTGG + Intronic
925068918 2:951031-951053 CAGGCAGCCCTGGCGTCCGCGGG - Exonic
925295938 2:2777459-2777481 CAGCAAGCTCTGGGCTGTCCTGG - Intergenic
925350198 2:3195806-3195828 CAGGACCCTCTGTGCTGCGCTGG + Intronic
926128556 2:10286360-10286382 CAGGAAGGGCTGGGCAGCACCGG + Intergenic
926905962 2:17805929-17805951 CTGGAAGGCCAGGGCTGGGCTGG + Intergenic
927600459 2:24435934-24435956 CAGGAGGCTCTGGGGAGCGCTGG + Intergenic
927696457 2:25242716-25242738 CGGGAAGCCCTTGGCTGGGGGGG + Intronic
927960922 2:27240282-27240304 CAGGAAGCCCTGGGATGCCACGG - Exonic
928149197 2:28810923-28810945 GCGGAAGCCCGGGGCTGCGCGGG - Exonic
928426052 2:31178734-31178756 GAGGGAGCCCTGGGCTGGACTGG - Intronic
931006026 2:57850539-57850561 CAGGGAGCCCTGGGCCTCCCCGG - Intergenic
931189083 2:59982394-59982416 CTGGAAGCCCTGGGCTGCAGAGG - Intergenic
931634264 2:64327768-64327790 CAGGAAGCCGTGGGCTGGGAGGG + Intergenic
932892477 2:75609035-75609057 CAGGAGCCCCAGGGCAGCGCAGG - Intergenic
933660581 2:84924370-84924392 CAGGAAGGAATGGGCTGCACCGG - Intergenic
933986140 2:87593902-87593924 CAGGCAGCCCAGAGCTGCCCAGG + Intergenic
934035520 2:88085755-88085777 CAGGGAGCCCAGGGCAGCACTGG - Intronic
934056838 2:88258359-88258381 CAACAAGCCCTGGGCTGCCCTGG - Intergenic
936028749 2:109054296-109054318 CAGGATGCCCTGGGGAGAGCAGG - Intergenic
936307696 2:111356901-111356923 CAGGCAGCCCAGAGCTGCCCAGG - Intergenic
937307907 2:120883546-120883568 CAGGAAGCTCTGGTGTGTGCAGG + Intronic
937358289 2:121212036-121212058 CTGGAAGTCCTGGGCTGTGGCGG - Intergenic
937988922 2:127651538-127651560 CAGGATGCGCTGGGTGGCGCAGG - Exonic
938159251 2:128970912-128970934 CAGGAAGCTCTGGGCACTGCAGG - Intergenic
939869092 2:147507208-147507230 CGGGAAGGCTGGGGCTGCGCAGG - Intergenic
939984185 2:148814031-148814053 GAGGAAGCCCCAGGCTGGGCAGG - Intergenic
940639017 2:156329155-156329177 CAGGAGACCATGGGCTGCGGCGG - Intronic
941160406 2:162028559-162028581 CAGGAAGGCCTGGACTGCAGGGG - Intronic
941911906 2:170771561-170771583 CGGGAAGCCCTGGGATGGGCTGG - Intergenic
945245272 2:207711778-207711800 CCGGCAGCCCCGGGCTACGCTGG - Exonic
946225275 2:218261171-218261193 CAGGAAGGCCCAGGCTGGGCAGG + Exonic
946325631 2:218983434-218983456 CAGGAAGCTCTTTGCTGGGCTGG - Intronic
946583856 2:221161417-221161439 CAGGGAGCCCTGGGCTGCTGTGG - Intergenic
947746164 2:232508381-232508403 TAGGAAGTCCTGGGCAGCCCTGG - Intergenic
947801896 2:232933880-232933902 CAGGAAGCCATGGGCTCCTTAGG + Intronic
948088161 2:235267694-235267716 CAGGGAACCCTGGCCTGGGCTGG - Intergenic
948100666 2:235370249-235370271 GAGGAAGCTCTGGGCTGAGCAGG + Intergenic
948100835 2:235371375-235371397 GAGGAAGCTCTGGGCTGAGCAGG - Intergenic
948115540 2:235492739-235492761 CAGGAAGCCCTGGTGAGCACTGG + Intergenic
948259437 2:236591965-236591987 CTGGAAGCTCTGTGCTGAGCTGG + Intergenic
948800742 2:240432401-240432423 CTGGCAGCCCTGGGCAGAGCAGG - Intergenic
948868138 2:240785552-240785574 CAGGAAGCCCAAGGCTGCTGAGG + Intronic
948921759 2:241069177-241069199 CAGGAGCCGCTGGGCTGGGCTGG + Intronic
1168814701 20:728526-728548 CACGAAGCCCGGGGCGGAGCAGG - Intergenic
1169001196 20:2169136-2169158 CAGGCAGATCTGGGCTGGGCTGG - Intronic
1169265001 20:4162146-4162168 CAGGAAGCGCAGGGCGGCCCGGG + Intronic
1170122281 20:12924279-12924301 CTGGAAGCCCTGGGCTGCCAAGG + Intergenic
1171461854 20:25302490-25302512 CAGGAGGCCCGGGGGTGGGCTGG + Intronic
1172006217 20:31820397-31820419 CAAGAAGCCCAAGGCTGAGCAGG + Exonic
1172107169 20:32523718-32523740 CAGGCAGCCCAGGGCAGCGGAGG - Intronic
1172533624 20:35653288-35653310 CAGGCAGTCCTGTGCTGGGCAGG + Exonic
1172773472 20:37394616-37394638 CAGGGGTCCCTGGGCTGCACTGG + Intronic
1172822420 20:37749156-37749178 CAGGAAGACCTGAGGTGCACTGG - Intronic
1173811234 20:45957170-45957192 GAGGAAGCCCTGGGGTCTGCAGG + Intronic
1174052724 20:47778533-47778555 CAAGAAGCCCTGGCCTGGGCTGG + Intronic
1174726163 20:52864383-52864405 CAGCAAGCCCAGTGCTGTGCAGG - Intergenic
1175228473 20:57459253-57459275 AAGTAAGCCCTGGGCTGCCAGGG - Intergenic
1175254190 20:57629086-57629108 CAGGGAGGCTTGGGCTGCACAGG - Intergenic
1175316745 20:58053988-58054010 CAGGAAGCCCTGAGTGGTGCTGG - Intergenic
1175737432 20:61396806-61396828 CTGGAAGCCCTGGGGTGGGGAGG + Intronic
1175802937 20:61811542-61811564 CAGGGAGCCCTGGGATGTTCTGG - Intronic
1176010444 20:62890859-62890881 CAGAGAGCCCTGGGCTGGTCAGG + Intronic
1176429995 21:6569657-6569679 CTGGAAGGCCAGGGCTGTGCTGG + Intergenic
1176860701 21:14010167-14010189 CTGGGAGCCCTGGGCTGGGCAGG + Intergenic
1178426423 21:32482538-32482560 CAGGGAGCCCTGGGCTTCCGAGG - Intronic
1178916406 21:36707873-36707895 CAGGAGCCCCCGGGCAGCGCGGG - Intronic
1179705389 21:43177119-43177141 CTGGAAGGCCAGGGCTGTGCTGG + Intergenic
1179726003 21:43341561-43341583 CTGGCAGCCCTAGGCTGCCCGGG + Intergenic
1179885697 21:44313392-44313414 AAGGAAGTCCTGGGCTGGCCAGG + Intronic
1180067992 21:45422335-45422357 CAGGAGGCCCTGGGCTTGGTGGG + Intronic
1181547339 22:23609586-23609608 CAGGGAGCCCTGGGCCTCTCTGG + Intronic
1182097884 22:27638263-27638285 CAGGAAGGCCAGGGCGGGGCTGG - Intergenic
1182359980 22:29740619-29740641 CGGGATGCCCTGGGCTAAGCGGG - Intronic
1182429877 22:30293166-30293188 CAGGCTGCCCTGGGCAGCGGTGG - Intronic
1182685579 22:32120178-32120200 CAGGAACCGCTGGGCTCAGCCGG + Intergenic
1182975364 22:34619246-34619268 ATTGAAGCCCTGGGCTGGGCAGG + Intergenic
1183905105 22:41034605-41034627 CAGGAAGCCTTGGGGTACACAGG + Intergenic
1184071824 22:42151603-42151625 CAGCCAGCCCTGGGATGCGCAGG + Intergenic
1184288848 22:43487500-43487522 CAGGGAGCCATGGGAGGCGCTGG + Intronic
1184332512 22:43835146-43835168 CAGGAAGCTCAGGGCTGCGGTGG - Intronic
1184474310 22:44712297-44712319 GATGAAGCCCTGGGCAGAGCTGG + Intronic
1184495708 22:44840058-44840080 CTGGAAACCCTGAGCTGCCCTGG - Intronic
1184636523 22:45836512-45836534 CAGGAAGCCCAGGGCTCCCTGGG + Intronic
1184694750 22:46133135-46133157 CAGTCAGCCCTGGGCTGTGGGGG + Intergenic
1184746894 22:46461469-46461491 CAGGAAGCTTGGGGCTGCACTGG - Intronic
1184768821 22:46586439-46586461 CAGGGAGCCCTGGGCTGGGGAGG - Intronic
1185065469 22:48629745-48629767 CAGGAAACCCTGGGATGCTTGGG + Intronic
1185199104 22:49491192-49491214 CAGGCACCTCTGGCCTGCGCTGG - Intronic
950517850 3:13479457-13479479 CTGGGATCCCTGGGCTCCGCGGG - Intergenic
950574902 3:13826386-13826408 CAAGAAGGCCAGGGCTGAGCTGG + Intronic
950628711 3:14267238-14267260 CTGGAGGCCCTGGGCAGCCCTGG - Intergenic
950727280 3:14924525-14924547 CTGGAGGCCATGGGCTCCGCAGG + Intronic
951415484 3:22417248-22417270 CAGGGAGGCTTGGGCTGAGCAGG - Intergenic
951551514 3:23879661-23879683 CAGGGAGGCCTGGGCCGCGGCGG + Intronic
952253756 3:31678195-31678217 CAGGAGGCCATGTGCTGTGCTGG + Intronic
952340158 3:32438790-32438812 CAGGAAGACCTGACCTGCACAGG + Intronic
953744176 3:45560570-45560592 CAGCAATCCCTGGCCTTCGCGGG + Intronic
954082289 3:48219714-48219736 CAGAAAGCCCAGGGCTTTGCAGG - Intergenic
954136460 3:48584312-48584334 CAGGAAGCCCTGGGGGGCCACGG + Exonic
954334647 3:49909228-49909250 AAGGCAGCCCTGGGATGGGCTGG - Intronic
954624577 3:52015597-52015619 CAGCATGCCCTGGGCTGTGCCGG + Intergenic
954801431 3:53189247-53189269 GTGGAGGCCCTGGGCTGGGCTGG + Intronic
956632639 3:71331395-71331417 CGGGGAGGCTTGGGCTGCGCAGG - Intronic
956798823 3:72738949-72738971 CAGGAGGCCCTGCGCGGCTCCGG + Intergenic
957080729 3:75633780-75633802 CAGGAAGGCCAGGGCTGGGCGGG - Intergenic
957721093 3:84000297-84000319 GATGAATCCCAGGGCTGCGCAGG + Intergenic
960556240 3:119034324-119034346 AAGGAACACCTGGGCTGCGCGGG + Intronic
961357671 3:126349322-126349344 CAGGAAGCCCGGGGCATGGCTGG + Intronic
961382151 3:126501907-126501929 CAACAAGCCCTGGGCTGGGCCGG - Exonic
961618692 3:128205832-128205854 CAGGAGGCCCTGGCCTGCTAAGG + Intronic
962339190 3:134567707-134567729 CAGGAACCCCTGCGGTGTGCAGG - Intronic
963074767 3:141335567-141335589 CATGATGCCCTGGGCTGGGCTGG + Intronic
964198184 3:154088269-154088291 CGGGGAGACTTGGGCTGCGCAGG - Intergenic
966103678 3:176308934-176308956 CAGGAAGCTTTGGCCTGTGCAGG + Intergenic
966914516 3:184577488-184577510 GAGGAGGCCTTGGGCTGAGCTGG + Intronic
968472118 4:786995-787017 CAGGATGCCAGGGGCTGGGCTGG - Intronic
968510596 4:993839-993861 CCGGCAGCCTTGGGCTGAGCCGG - Intronic
968659637 4:1793703-1793725 CCGGGAGCCCTGGGCGGCGGCGG + Intronic
968948810 4:3679631-3679653 CAGGAACCCCTGGGAAGAGCAGG - Intergenic
968964136 4:3761018-3761040 CAGGGAGCCGTGGCCTGGGCTGG - Intergenic
969105976 4:4807332-4807354 CAGGAGGGCCAGGGCTGGGCTGG + Intergenic
969531248 4:7732405-7732427 GAGGAAGCCCTCCTCTGCGCCGG + Intronic
969695923 4:8734833-8734855 CAGGCAGCCCTGGCCTGGCCAGG - Intergenic
969715058 4:8864358-8864380 CTGGAAGCCCTGAGCAGCTCAGG + Intronic
970236172 4:13960368-13960390 CAGGAAGTCATGGGCTACCCAGG - Intergenic
970434822 4:16023265-16023287 CAGGAGTCCCTGGGCTTGGCAGG - Intronic
972321475 4:37977133-37977155 CGAGATGCCCAGGGCTGCGCAGG - Intronic
973041765 4:45477413-45477435 CAGGGAGGCTTGGGCTGTGCAGG + Intergenic
973190270 4:47378105-47378127 CAGGGAGGCTTGGGCTGCACAGG + Intronic
973773729 4:54227878-54227900 CAGGGCGCCTGGGGCTGCGCTGG - Intronic
975690633 4:76959114-76959136 CAGGAAGCCTTGGACACCGCAGG - Intronic
978143483 4:105344362-105344384 CAGGAAGCTCTGGGGTCTGCTGG - Intergenic
979547263 4:121951931-121951953 GAGGAAGCCCGGGGCCGAGCGGG + Intergenic
980532296 4:134071158-134071180 CAGGAAGCCATGAGCTGAACAGG - Intergenic
981636625 4:146888404-146888426 TAGGAAGCCCAGGGCTGCAGGGG - Intronic
983425745 4:167581854-167581876 CAGGGAGGCCTGGGCCGTGCAGG - Intergenic
985765687 5:1778278-1778300 CAGGAAACCCTGGGCTGCTCAGG - Intergenic
985822923 5:2172610-2172632 CAGGCACCCCTGTGCTGGGCGGG - Intergenic
986126418 5:4886311-4886333 CAGGAGGGCCTGGGCTCCCCTGG + Intergenic
986134001 5:4957709-4957731 CAGGAAGGGCAGGGCTCCGCGGG + Intergenic
986403012 5:7396864-7396886 CAGGAAGCCCAGGGCTGAGTCGG - Intronic
990969948 5:61494388-61494410 CAGGCAGCTCTGGGATGAGCTGG + Exonic
991558497 5:67923268-67923290 CAGGAAGCACTGGGCTTCCAGGG - Intergenic
992460850 5:76958517-76958539 CAGGAGGCCCTGGGCTGTGAGGG - Intronic
993678565 5:90847579-90847601 CAGGGAGGCTTGGGCTGCTCAGG + Intronic
997367225 5:133333760-133333782 CAGGAGGCCCTGCGCAGTGCAGG - Intronic
998040138 5:138946412-138946434 CAGGCAGGCCTGGGCTCCCCTGG + Intergenic
998849286 5:146338628-146338650 AGGGTAGCCCTGGGCTGAGCTGG - Intronic
999846072 5:155481570-155481592 CAGAAAACCCTGGACTGCTCAGG - Intergenic
1001103111 5:168830242-168830264 ATGGAGGCCCTGGGCTGAGCGGG - Intronic
1001332372 5:170771428-170771450 GAGGAAGGCCTGGGCAGAGCAGG + Intronic
1002020610 5:176361832-176361854 CAGCATGCCCTGTGCTCCGCTGG - Exonic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1002698301 5:181104732-181104754 GAGGCAGCCCTGGGCTGAGTTGG + Intergenic
1002702171 5:181131770-181131792 CAGGAAGCCATGGCCGGCGGAGG - Intergenic
1002708593 5:181180176-181180198 GAGGCAGCCCTGGGCTGAGTTGG - Intergenic
1002785765 6:398762-398784 CAGGAAGCCCCGCGGTGCGTCGG + Intronic
1003048907 6:2763399-2763421 CAGGGAGGCTTGGGCCGCGCAGG + Intergenic
1003736939 6:8887464-8887486 CGGGAAGGCTTGGGCTGCACAGG - Intergenic
1004053109 6:12108451-12108473 CGGGGAGGCTTGGGCTGCGCAGG + Intronic
1004304509 6:14487766-14487788 CATAAAGCCCTGGGCTCAGCCGG + Intergenic
1005849849 6:29813246-29813268 CAGGAAGCCCTGGGGCTCACAGG + Intergenic
1005927306 6:30454013-30454035 TGAGAAGCCCTGGACTGCGCGGG + Intergenic
1005930835 6:30482393-30482415 TGAGAAGCCCTGGACTGCGCGGG + Intergenic
1006115907 6:31776126-31776148 CAGGAAGTCCTGGGCTGCATTGG + Exonic
1006478279 6:34272255-34272277 CAGGACACCCTGGGCTGGCCTGG - Intergenic
1007253104 6:40509866-40509888 CAGGGAACACTGGGCTGCGTAGG + Intronic
1007407329 6:41642548-41642570 CAGGAAGACCTGGTCTGCAGAGG - Intronic
1007427272 6:41755698-41755720 CAGGGAGTCCTGGGCTGCTGGGG + Intergenic
1008493314 6:52108145-52108167 CACGAGGCCCTGGGCTGGGAAGG - Intergenic
1016172901 6:141041685-141041707 CAGGGAGGCTTGGGCCGCGCGGG + Intergenic
1018012683 6:159686014-159686036 CAGGAAGAGCTGGGCTGCCTTGG - Intronic
1019035205 6:169048962-169048984 CAGGAACCCTAGGGCTGGGCGGG - Intergenic
1019134055 6:169897248-169897270 AGGGAGGCCCTGGGCTGCCCAGG - Intergenic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1022475201 7:30705469-30705491 CAGGAAGGCCAGGGCAGAGCAGG + Intronic
1022496898 7:30859121-30859143 CAGCAACCCCAGGGCTGGGCTGG + Intronic
1023090840 7:36616005-36616027 CAAGAAGCTCTGGGCAGAGCAGG - Intronic
1023871961 7:44268169-44268191 GAAGACGCCCTGGACTGCGCAGG + Intronic
1024236557 7:47403117-47403139 AAGGAGGCCCTGCGCTGGGCGGG - Intronic
1024811697 7:53219432-53219454 CAGGACTCGCGGGGCTGCGCCGG - Intergenic
1025957860 7:66196486-66196508 CAGTCAGTCCTGGTCTGCGCTGG + Intergenic
1027233595 7:76285540-76285562 CAGGAAGCCCTGGCCGCTGCTGG + Intronic
1029111426 7:98214734-98214756 CAGGAAGCCCTGGGCTGCGCTGG - Exonic
1029446305 7:100614806-100614828 CTGGAGGACCTGGGCTGGGCAGG + Intronic
1029984940 7:104914465-104914487 CAGGCAGCACTGGGATGTGCTGG + Intergenic
1030876828 7:114823657-114823679 CAGGAAGAATTGGGCTGCTCTGG + Intergenic
1031605495 7:123763277-123763299 CAGGGAGGCTCGGGCTGCGCAGG + Intergenic
1032057811 7:128697639-128697661 CAGGAGGTCCCGGGCTGCGACGG - Intergenic
1032238108 7:130141603-130141625 CAAGGCGCGCTGGGCTGCGCAGG - Intergenic
1033459742 7:141535256-141535278 CAGTAAGCCCTGGGAGGGGCAGG - Intergenic
1034104914 7:148482073-148482095 GAGGAAGCCCTGGGGTGAGGGGG - Intergenic
1034551149 7:151821503-151821525 CAGAAGGCCCCGGGCTGCCCAGG + Intronic
1035349828 7:158238163-158238185 AAGGACGCCCTGGGCTTGGCTGG + Intronic
1035381979 7:158446147-158446169 CAGGAAGACCTGGGGCGAGCTGG - Intronic
1035609143 8:948704-948726 AAGGGTGGCCTGGGCTGCGCTGG - Intergenic
1035683531 8:1507219-1507241 CAGGGAGGCTTGGGCCGCGCGGG + Intronic
1035734277 8:1876420-1876442 GAGCAAGCCCGGGGCTCCGCAGG + Intronic
1036135573 8:6157999-6158021 CAGCATGCCCAGGGCTGCCCAGG + Intergenic
1036204356 8:6794317-6794339 CAGGAAGGCGTGGGCCGCCCAGG - Intergenic
1037822171 8:22140308-22140330 CTGGAATCTCTGGGCTGGGCTGG - Intronic
1037894651 8:22643818-22643840 CAGGAAGTCCGGTGCTGTGCTGG - Intronic
1037959317 8:23084275-23084297 CTTGGAGCCCTGGGCTGGGCTGG + Intergenic
1037989072 8:23307676-23307698 GTGGAAGCCCTGGGCGGCGGGGG - Intronic
1038011539 8:23480325-23480347 CAGAACGCCCTGGGCTCGGCAGG + Intergenic
1039379389 8:37070739-37070761 GAGGAAGCCCTGGCCTGTCCAGG - Intergenic
1040414360 8:47183310-47183332 TAGGAAGCTCTGGGCTGTGCAGG + Intergenic
1040561930 8:48530299-48530321 CTGGAGGCCCTGAGCTGCCCTGG + Intergenic
1042467231 8:69141274-69141296 CAGGCAGGCATGGGCTGCTCGGG + Intergenic
1042776271 8:72435430-72435452 GAGGCAGCCCTGTGCTGCCCAGG + Intergenic
1044136133 8:88588402-88588424 AAGGAAGCCATGGGATGGGCAGG - Intergenic
1045259419 8:100559413-100559435 GGGGAACCCCTGGGCAGCGCGGG - Intronic
1046450754 8:114386455-114386477 CAGGTAGGCTTGGGCTGCACAGG - Intergenic
1046654069 8:116874261-116874283 GGGGAAACCCTGGGCTGCGGAGG - Intronic
1047403061 8:124562182-124562204 CTGGAACCACTGGGCTGGGCTGG + Intronic
1049195559 8:141313838-141313860 CTGAAAGCCCTTGGCTGCCCAGG - Intergenic
1049201793 8:141343915-141343937 CAGGAAGCCCAGGGCTCCAAGGG - Intergenic
1049361370 8:142213889-142213911 CAGGAAGCCCTGGCCTTTCCAGG + Intronic
1049409100 8:142464584-142464606 CAGGAAGGCCAGGGGTGCGGAGG - Exonic
1049605522 8:143527420-143527442 GCTGAAGACCTGGGCTGCGCAGG - Intronic
1049708275 8:144052590-144052612 CAGGCAGCCCTGTGCGGGGCGGG + Exonic
1050889566 9:10807097-10807119 CAGAAAGCCTGGGGCTGTGCTGG - Intergenic
1051142616 9:13993989-13994011 CAGGAGGCCATGGGCTGTGCAGG + Intergenic
1052792157 9:32885865-32885887 CAAGGAGCCCTGGGGTGCACGGG + Intergenic
1053050642 9:34958321-34958343 CGGGCTGCCGTGGGCTGCGCGGG + Exonic
1053157603 9:35791691-35791713 GAGGAAGCGCCGGGCAGCGCCGG + Intergenic
1056505795 9:87257168-87257190 CAGGCAGCCCTGGGCTGGAGTGG - Intergenic
1057428982 9:94977319-94977341 CTGAAAGCCCAGGGCTGCTCCGG - Intronic
1057516072 9:95722490-95722512 CAGGAAGGCCTGCTCTGGGCTGG + Intergenic
1057798594 9:98175432-98175454 CAGGGAGCCCTGCTCTGTGCAGG + Intronic
1057804193 9:98208990-98209012 GAGGGAGCGCTGGGCTGCCCTGG - Exonic
1060548006 9:124471916-124471938 CATGAAGCCCTGGGGGGCGTGGG - Intronic
1060874060 9:127067472-127067494 TAGGGAGCCCTGGGCTGCTTTGG - Intronic
1060932677 9:127498616-127498638 CAGGAAGCCCTGAGCAGCCCAGG - Intronic
1060991681 9:127853355-127853377 CAGGAAGCCCCTGGATGCACAGG + Intronic
1061782916 9:133006382-133006404 CAGGGAGCCCTGCTCTGGGCTGG + Intergenic
1061945688 9:133907249-133907271 CAGCAAGCCCTGCCCTGCCCAGG + Intronic
1062099442 9:134720578-134720600 CCGGAAGCCCTGGGTTGAGAAGG + Intronic
1062102490 9:134735715-134735737 GAGAAAGCCCAGGGCTGAGCTGG - Intronic
1062108364 9:134768007-134768029 CAGGATGCCCTGCCCTGCCCTGG + Intronic
1062110083 9:134777478-134777500 CAAGAAGCCCTGGGAAGTGCTGG + Intronic
1062207521 9:135345407-135345429 CTGGAAGACCTGGGCTTCTCAGG + Exonic
1062269799 9:135703187-135703209 CAGGGAACCCTGGGCAGAGCCGG + Intronic
1062339792 9:136088860-136088882 CAGGATGCCGGGGGCTGGGCTGG - Intronic
1062353241 9:136149235-136149257 CAGGCAGCCCCAGGCTGAGCTGG + Intergenic
1062717780 9:138019645-138019667 AAGGAAGCACTGGGCAGGGCGGG - Intronic
1185798917 X:2991782-2991804 CAGGCAGCCCTGGGCACCGTAGG - Intergenic
1189383942 X:40521538-40521560 CAGGAAGCCGTGGGCTACGAGGG - Intergenic
1189593630 X:42541710-42541732 CAGGAAGCCCTGGGGTAGTCAGG - Intergenic
1191183597 X:57587222-57587244 CAGGAAGTCCTGGGTAGGGCTGG + Intergenic
1198400884 X:136267173-136267195 CAGAAAGCCTAGGGCTGAGCCGG - Intergenic
1198655139 X:138905686-138905708 CAGGAAGCCCTGACATGCTCTGG + Intronic
1199610248 X:149606648-149606670 CAGGAAGCCCTGTGTTGGGAGGG - Intronic
1200086762 X:153610934-153610956 CAGAAAGCACTGGGCTGTGAGGG - Intergenic
1200117041 X:153773986-153774008 CAGGAAGCCCTGGCCCCCACTGG - Exonic
1200925756 Y:8653105-8653127 CAGGAAACCCTAGGCTGAGGAGG - Intergenic
1201063769 Y:10070139-10070161 GGGGATGCGCTGGGCTGCGCAGG + Intergenic
1201469135 Y:14314748-14314770 CAGGGAGGCTTGGGCTGTGCAGG - Intergenic
1201573064 Y:15434141-15434163 CAGGGAGGCTTGGGCTGCACAGG - Intergenic
1202128939 Y:21592873-21592895 CAGGAAACCCTAGGCTGACCAGG - Intergenic