ID: 1029111732

View in Genome Browser
Species Human (GRCh38)
Location 7:98216194-98216216
Sequence GGCGAGAGGCTGGCCCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029111732_1029111741 18 Left 1029111732 7:98216194-98216216 CCGGGCCGGGCCAGCCTCTCGCC 0: 1
1: 0
2: 0
3: 35
4: 303
Right 1029111741 7:98216235-98216257 GTGCACCCTGCTCCATGTACAGG 0: 1
1: 0
2: 1
3: 9
4: 92
1029111732_1029111738 -10 Left 1029111732 7:98216194-98216216 CCGGGCCGGGCCAGCCTCTCGCC 0: 1
1: 0
2: 0
3: 35
4: 303
Right 1029111738 7:98216207-98216229 GCCTCTCGCCACAGGATGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 144
1029111732_1029111742 22 Left 1029111732 7:98216194-98216216 CCGGGCCGGGCCAGCCTCTCGCC 0: 1
1: 0
2: 0
3: 35
4: 303
Right 1029111742 7:98216239-98216261 ACCCTGCTCCATGTACAGGACGG 0: 1
1: 0
2: 0
3: 21
4: 180
1029111732_1029111746 29 Left 1029111732 7:98216194-98216216 CCGGGCCGGGCCAGCCTCTCGCC 0: 1
1: 0
2: 0
3: 35
4: 303
Right 1029111746 7:98216246-98216268 TCCATGTACAGGACGGGCTGAGG 0: 1
1: 0
2: 1
3: 6
4: 125
1029111732_1029111744 23 Left 1029111732 7:98216194-98216216 CCGGGCCGGGCCAGCCTCTCGCC 0: 1
1: 0
2: 0
3: 35
4: 303
Right 1029111744 7:98216240-98216262 CCCTGCTCCATGTACAGGACGGG 0: 1
1: 1
2: 1
3: 6
4: 137
1029111732_1029111748 30 Left 1029111732 7:98216194-98216216 CCGGGCCGGGCCAGCCTCTCGCC 0: 1
1: 0
2: 0
3: 35
4: 303
Right 1029111748 7:98216247-98216269 CCATGTACAGGACGGGCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029111732 Original CRISPR GGCGAGAGGCTGGCCCGGCC CGG (reversed) Exonic
900414793 1:2530026-2530048 GGTGTCAGGCTGGCCCGGCACGG + Intronic
900418653 1:2546261-2546283 GGGGTGGGGGTGGCCCGGCCCGG + Intergenic
900502840 1:3015067-3015089 GGCTTGAGGCTGGCCGGGCAAGG - Intergenic
900609571 1:3538858-3538880 GGCGTGGGGCTGGCCTTGCCTGG - Intronic
900923026 1:5685637-5685659 GCCCAGTGCCTGGCCCGGCCCGG - Intergenic
902078187 1:13803743-13803765 ATAGGGAGGCTGGCCCGGCCTGG - Intronic
902643034 1:17778964-17778986 GGGGAGAGGCAGGCAGGGCCTGG - Intronic
902932255 1:19739925-19739947 GGAGTGAGGCTGGCCAGGTCAGG + Exonic
903132777 1:21290344-21290366 GGGGTGAGGCGGGCGCGGCCTGG - Exonic
903179403 1:21597818-21597840 GGGGTGGGGCTTGCCCGGCCTGG - Intronic
903372289 1:22844435-22844457 GCTGAGAGGCTGGCCCAGCCAGG + Intronic
903467078 1:23559156-23559178 GTCCAGGGGCTGGCTCGGCCAGG + Exonic
903945411 1:26959738-26959760 GGGCAGAGGCTGGTGCGGCCGGG - Intronic
904310358 1:29625339-29625361 GGGGAGAGGCTGGTCCACCCTGG + Intergenic
905617240 1:39409382-39409404 GACCTGAGGCTGGCGCGGCCGGG + Intronic
906220377 1:44073665-44073687 GCAGAGAGGCTGGCCCTGGCTGG + Intergenic
906240823 1:44241134-44241156 GGGGAGGGGCTGGCCTGGTCTGG + Intronic
906652354 1:47521740-47521762 GGTAACAGGCTGCCCCGGCCAGG + Intergenic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
908534751 1:65067138-65067160 GGCGCGGGGCGGGCCGGGCCGGG - Intergenic
914437041 1:147669808-147669830 GGTGAGAGGTCGGCCCGGGCTGG - Exonic
915835397 1:159171826-159171848 TGGGAGAGGTTGGCCCCGCCGGG - Exonic
916535394 1:165698684-165698706 GGCGAGGGGAGGGCCTGGCCTGG - Exonic
917442430 1:175079419-175079441 TGCGAGCGGCTGGCCTGCCCCGG + Exonic
920310185 1:205044014-205044036 GGCGAGAGGCTGGGGCTACCGGG + Intronic
920647564 1:207814617-207814639 GGCTAGAGTCTGGCCAGCCCTGG - Intergenic
923035267 1:230281018-230281040 TCAGAGAGGCTGGCACGGCCTGG + Exonic
923400770 1:233614065-233614087 GGCGGGAGCCAGGCCCGGGCGGG + Exonic
923544118 1:234911966-234911988 GTAGAGAGGCTGCCCCGGGCTGG + Intergenic
924188277 1:241519465-241519487 GCCCAGAGTCTGGCGCGGCCCGG + Intronic
1062857801 10:788112-788134 GCCCAGTGGCTGGCCCAGCCTGG - Intergenic
1063184584 10:3639016-3639038 GGGAGGAGGCTGGCCCGGCTGGG - Intergenic
1063225261 10:4009607-4009629 GGCGTAAGCCTGGCCCGGCCTGG + Intergenic
1064380638 10:14838606-14838628 GGCGCGAGGCCGGGCCTGCCCGG - Intronic
1067145331 10:43689804-43689826 GCGGAAAGGCTTGCCCGGCCGGG - Intergenic
1067883577 10:50068025-50068047 GGAGAGAGGCCGGCCTGGGCTGG + Intronic
1070837455 10:79458805-79458827 GGCAAGAGGCTGGCCAAGCAGGG - Intergenic
1070877554 10:79827122-79827144 ATCAAGAGGCTGGCCCGGCCAGG - Intergenic
1071546953 10:86536438-86536460 GCCGGGACACTGGCCCGGCCGGG - Intergenic
1071573841 10:86711847-86711869 GCGGAGAGCCGGGCCCGGCCCGG + Intronic
1071644049 10:87343168-87343190 ATCAAGAGGCTGGCCCCGCCAGG - Intergenic
1072003594 10:91220929-91220951 GGCTCCAGGCTGGGCCGGCCAGG - Intronic
1072454215 10:95561667-95561689 GGCCAGCGTCCGGCCCGGCCAGG - Intergenic
1072926501 10:99621042-99621064 GGCGTGAGGCGGGGCCGGCCTGG + Intergenic
1074363243 10:112839196-112839218 GGAAAGGGGCTGGCCCTGCCAGG - Intergenic
1075144522 10:119872362-119872384 GGGGAGAGGCTGTCCCAGCTGGG + Intronic
1075667459 10:124241131-124241153 GGCCAGCAGCTGGCCCGGCCTGG - Intergenic
1075714739 10:124549710-124549732 GGCCAGAGGCAGGCCCAGCCTGG - Intronic
1075802306 10:125160796-125160818 GGCGCGGGGCGGGCCCGGGCCGG - Intronic
1076776483 10:132700636-132700658 AGGGAGGGGCGGGCCCGGCCAGG - Intronic
1077150827 11:1072404-1072426 GGGGAGAGGCTGGGGGGGCCAGG + Intergenic
1077253553 11:1571243-1571265 GGGGAGGGGCTGGCACAGCCAGG - Intronic
1077479615 11:2807558-2807580 GGCCCGAGGAGGGCCCGGCCCGG - Intronic
1077537313 11:3130568-3130590 AGGGAGGGGCTGGCCCAGCCTGG - Intronic
1077539033 11:3138112-3138134 GGGGACGGGCTGGCCTGGCCGGG - Intronic
1077563617 11:3281973-3281995 GGTGAGGGGCAGGCCAGGCCTGG - Intergenic
1077569507 11:3327790-3327812 GGTGAGGGGCAGGCCAGGCCTGG - Intergenic
1078821990 11:14891927-14891949 GCCGCCAGGCTGGCCCGGGCTGG - Intronic
1080496901 11:32829758-32829780 GGCAGGCGGCTGGCCCGCCCGGG + Intergenic
1080737451 11:35030725-35030747 GGCGAGAGGCTGGGCCCAGCAGG + Intergenic
1081720704 11:45286256-45286278 GCCTGGAGGCGGGCCCGGCCCGG - Exonic
1081785220 11:45741789-45741811 GGCAAGAGGCTGGCTGGTCCAGG - Intergenic
1083163120 11:60867722-60867744 GCGGAGAGTCTGGCCTGGCCTGG - Exonic
1083572822 11:63769154-63769176 GGCGGGAGGCAGCCCCGGGCAGG - Intergenic
1083614599 11:64019974-64019996 GCAGGGAGGCTGGCCCTGCCTGG - Intronic
1083667893 11:64285406-64285428 GGCGAGGGGCGGGCCCGCGCGGG + Intronic
1083899759 11:65638042-65638064 GCCGGGAGGCGGGGCCGGCCGGG - Intronic
1084165351 11:67372778-67372800 GGCGGGGGGCTGGCGCAGCCGGG - Intronic
1084691640 11:70730648-70730670 GAGGAGATGCTGGCCTGGCCAGG - Intronic
1085266708 11:75241723-75241745 GGCGAGCAGCAGGCGCGGCCCGG - Exonic
1085394954 11:76202530-76202552 GGGGAGAGGCTGGGCTTGCCTGG - Intronic
1086450036 11:86906456-86906478 GGCTGGAGGCTGGCTCGGCGAGG + Intronic
1088401271 11:109423967-109423989 GGCGGGGGGCTGCCCCGACCTGG + Exonic
1089566592 11:119375065-119375087 GGCCAGAGGCTGGCCAGGCTGGG - Intronic
1091010579 11:131997235-131997257 GGCGAGAGGCTGGGTGGGCCAGG - Intronic
1091961690 12:4700968-4700990 GGCGGGAGACTGGCTGGGCCTGG + Intronic
1092118865 12:6029636-6029658 GGCGTGGGGCTGGCCCTGCAGGG - Intronic
1093508963 12:19903791-19903813 GGGGAGAGGCGGGCCTAGCCAGG - Intergenic
1096156759 12:49345468-49345490 GCCGACAGGCCGGGCCGGCCGGG + Intergenic
1096241286 12:49961666-49961688 GGCCGGCGGCTGCCCCGGCCGGG + Intergenic
1097251133 12:57632808-57632830 GGCGAGAGCCCGGCACAGCCCGG - Exonic
1097848652 12:64390549-64390571 GGCAAGGGGCTGGCCATGCCCGG + Exonic
1100539883 12:95548327-95548349 GGCGCGGGGCTGGCACGGGCTGG - Intronic
1101910549 12:108857612-108857634 GGGGAGGGGCGGGCCCGGCCCGG - Intergenic
1101946232 12:109139621-109139643 TGTGGGAGGCTGGCTCGGCCTGG - Exonic
1103473821 12:121203644-121203666 GAGGAGAGACTGGCCCGGCTGGG + Intergenic
1103626868 12:122226378-122226400 GGCGGGAGGCGGGGCCGGGCGGG + Exonic
1103745610 12:123121145-123121167 GGTGAGAGCTTGGCCAGGCCTGG - Intronic
1104719039 12:131034398-131034420 GGCGAGTGGCTGGCGAGGCTGGG - Intronic
1104887441 12:132118950-132118972 GCCGGGAGGCTGCCCCAGCCGGG + Intronic
1104961518 12:132490419-132490441 GGCGGGCGGCGGGCCGGGCCGGG - Exonic
1105507215 13:21020656-21020678 GGAGAGAGGCAGACCTGGCCTGG - Intronic
1106603742 13:31208955-31208977 GGGGAGGGGGTGACCCGGCCGGG - Intronic
1107082069 13:36385784-36385806 GGGGAGAGGCTGGCATGGCTTGG - Intergenic
1108114183 13:47109671-47109693 CGAGAGAGGCTGACCCAGCCTGG - Intergenic
1111163928 13:84432665-84432687 GGAGAAAGGCTGGCCTGGCATGG + Intergenic
1113254836 13:108495660-108495682 GGGGAGAGGCGGGGCCGGCGGGG + Intergenic
1113634530 13:111910508-111910530 AGCGAGGAGCCGGCCCGGCCAGG + Intergenic
1113804091 13:113103601-113103623 GGAGAGAGGGAGGCCTGGCCTGG + Intergenic
1114261389 14:21039141-21039163 GGAGAGAGGAGGGCCGGGCCTGG - Intronic
1117377388 14:55129126-55129148 GGCGCGGGGCTCGCCCAGCCTGG + Exonic
1118729240 14:68655009-68655031 AGAGAGAGGCTGGCCCCACCAGG + Intronic
1119180425 14:72601238-72601260 GGTGGGAGGCTGGCCAGGCTGGG - Intergenic
1119386642 14:74261483-74261505 GGGCAGAGGCTGGGCCTGCCTGG - Exonic
1120841948 14:89094026-89094048 GGGGAGAGGCTGGACCACCCAGG - Intergenic
1122746446 14:103899808-103899830 GGGGAGAGCCTGAGCCGGCCAGG + Intergenic
1122977693 14:105177670-105177692 GGTGAGAGCCTGGCCCAGCCTGG - Exonic
1123037192 14:105476277-105476299 GCTGAGAGGCTGGGCGGGCCAGG - Intronic
1123113396 14:105883192-105883214 GGCCAAAGGCTGGGCCTGCCAGG - Intergenic
1124629087 15:31327014-31327036 TGCGAGGCGCCGGCCCGGCCGGG - Exonic
1124662538 15:31562183-31562205 GGGGAGAGGCTGCCCCTCCCAGG + Intronic
1124712924 15:32030370-32030392 GCCGAGACGCTGGCCCGGGCTGG + Intergenic
1126406926 15:48331631-48331653 GCCGAGGGGCGGGCCTGGCCCGG - Exonic
1129162162 15:73752978-73753000 GGCGAGCGGCGGGCCGGGCCGGG + Intergenic
1129299155 15:74615625-74615647 GGCGGGAGGCGGGCCGGGCCAGG + Exonic
1129322369 15:74782298-74782320 GGCCAGAGGCTGGCTGGGGCGGG - Exonic
1130076581 15:80695250-80695272 GGCAGGAGGCGGGGCCGGCCCGG - Intronic
1130531075 15:84748402-84748424 GTGGAGGGGCTGCCCCGGCCTGG - Intergenic
1130598710 15:85262615-85262637 GGGGAGCGGCTGGCCTGGCTAGG + Intergenic
1132301527 15:100779121-100779143 GGCGAGCACCTGGCCAGGCCCGG - Intergenic
1132669255 16:1095993-1096015 GGCCAGGGGCTGGGACGGCCGGG - Intronic
1132697759 16:1209531-1209553 GGAGAGAAGCAGGCCAGGCCAGG + Intronic
1132841045 16:1978681-1978703 GGAGAGAGGCCGGACCGGCTAGG - Exonic
1133997497 16:10759398-10759420 GGAGGGAGGATGGCCTGGCCCGG + Intronic
1135040511 16:19114137-19114159 GGCCAGCTTCTGGCCCGGCCTGG - Intronic
1135707358 16:24686286-24686308 GCCGAGAGGCCAGCCTGGCCAGG + Intergenic
1137426382 16:48384856-48384878 CCCGGGAGGCGGGCCCGGCCGGG - Intronic
1137591443 16:49696546-49696568 GGGGAGAGGCCAGCCAGGCCTGG - Intronic
1139514949 16:67447335-67447357 GATGAGAGGCTGGACAGGCCTGG + Intronic
1139678192 16:68539614-68539636 GGGGAGCGGCAGGCCCGGGCTGG + Intronic
1139707299 16:68750100-68750122 AGTGAGAGGCAGGCCAGGCCTGG - Intronic
1141665308 16:85462718-85462740 GGCGGGAGGCGGCGCCGGCCGGG + Intergenic
1141957772 16:87383885-87383907 GGGGAGGGGGTGGCGCGGCCGGG - Intronic
1142170480 16:88619513-88619535 GGCCAGAGGCAGGCCCAGCAGGG - Intronic
1142177227 16:88650838-88650860 GGCGCCAGGCGGGCCAGGCCGGG - Intronic
1142182757 16:88679213-88679235 TGCGGGAGGCTGGCCTGGCCAGG - Intronic
1142213225 16:88818174-88818196 GGAGAGGGGCTGGCCTGGACAGG + Intronic
1142560248 17:805281-805303 CGGGAGATGCTGGCCCTGCCTGG + Intronic
1142577919 17:921612-921634 GATGAGAGCCTGGGCCGGCCAGG - Intronic
1142577942 17:921698-921720 GATGAGAGCCTGGGCCGGCCAGG - Intronic
1142577954 17:921741-921763 GATGAGAGCCTGGGCCGGCCAGG - Intronic
1142577966 17:921784-921806 GATGAGAGCCTGGGCCGGCCAGG - Intronic
1142577978 17:921827-921849 GGAGAGAGCCTGGGCCTGCCAGG - Intronic
1142794465 17:2296701-2296723 GGCTAGGGACTGGCCAGGCCCGG + Intronic
1142807086 17:2376863-2376885 GACGAGAGGGTGGCCAGGTCTGG + Intronic
1143479608 17:7220731-7220753 GGGGACAGGCTGGTCAGGCCAGG - Intronic
1143554140 17:7650464-7650486 GCCGGGAGGCTGGCCGAGCCAGG - Intronic
1143595971 17:7914252-7914274 TGCCAGAGTCTGGCCCGGCGCGG + Intergenic
1143676357 17:8435959-8435981 GCCGAGCGGCTGGGCGGGCCTGG + Exonic
1144695941 17:17303838-17303860 GGCGAGAAGGAGGCCCGGCGCGG - Intronic
1144737035 17:17561014-17561036 GGGGAGAGGAAGGCGCGGCCGGG - Intronic
1146896631 17:36545832-36545854 GGGGAGCGGCGGGCCCAGCCCGG - Intronic
1148206766 17:45784355-45784377 AGCGAGAGCCGGGCCGGGCCGGG + Intronic
1148262052 17:46192943-46192965 GGAGAGCGGCGGGCCCGGGCCGG - Intronic
1148837603 17:50474112-50474134 GACCAGGGGCTGGCCTGGCCAGG - Intronic
1149659316 17:58326124-58326146 GGGCAGAGGCTGGCCAGGCAAGG - Intronic
1150258989 17:63773457-63773479 GCCGAGAGGCAGGCCGGGCAGGG - Exonic
1150338367 17:64346044-64346066 GGCTAGTGGCTGGCACGGCCTGG + Intronic
1152340662 17:79722363-79722385 GGCCAGGGGCTGGCCTGCCCAGG - Intergenic
1152660688 17:81540582-81540604 GACGCGAAGCTGGACCGGCCAGG + Exonic
1153489185 18:5630230-5630252 GGGGCGAGGCTGGCCCGACCGGG - Intronic
1155910328 18:31498137-31498159 AGGGAGAGGGTGGCCGGGCCGGG + Exonic
1160452136 18:78973459-78973481 TGCGAGGGGCTGGGCCGTCCAGG + Intergenic
1160499714 18:79395744-79395766 GGCGAGCGGCTGCCGCGGCGCGG + Intergenic
1160766879 19:812715-812737 GGCGAGGGGCTGCCCCCGCTGGG - Exonic
1160873874 19:1288425-1288447 GGTGTGAGGCTGGGCTGGCCGGG + Intronic
1160888006 19:1360949-1360971 GGAGGGAGGCGGGCCCAGCCTGG - Exonic
1160947833 19:1651909-1651931 GGGTAGAGGGGGGCCCGGCCCGG - Intronic
1161001264 19:1912380-1912402 GGCCCGAGGCCGGCCCAGCCAGG - Exonic
1161468655 19:4445700-4445722 GGCGCGGGGATGCCCCGGCCTGG + Intronic
1161482390 19:4517532-4517554 GGTGAGTGGCTGGCCCAGCTGGG - Exonic
1161505421 19:4640964-4640986 GGCCAGAGGCTGGAGCAGCCTGG + Intronic
1162934415 19:13974322-13974344 GGAGAGAGGCTTCCCCAGCCTGG - Intronic
1162964230 19:14148487-14148509 GGCGAGGAGCTGGCCTGTCCCGG - Exonic
1163145208 19:15374921-15374943 GCCAAGAGGTTGGCCAGGCCAGG + Intronic
1163296817 19:16417947-16417969 GGAGAGAGGCACGCCCGGCCCGG - Exonic
1163370689 19:16899690-16899712 GCTGAGAGGCTGGCAGGGCCTGG - Intronic
1163584408 19:18156125-18156147 GGCGAGGGCCGGGCCGGGCCAGG - Exonic
1164698124 19:30262205-30262227 GGTGAGAGGCTGAGCCTGCCTGG + Intronic
1165320781 19:35083945-35083967 GAGGAGGGGCTGGCCCAGCCTGG + Intergenic
1165803217 19:38565511-38565533 GGCGAGCAGCCGGCCGGGCCGGG + Exonic
1166046667 19:40234253-40234275 TGCGAGAGGCAGGCCAGGACAGG - Intronic
1166198261 19:41220353-41220375 GGGCAGGGGCTGGCCCTGCCAGG + Intronic
1166568203 19:43777875-43777897 GGCGGGATGCTGGCCCAGCCAGG - Intronic
1167253709 19:48415073-48415095 GTCGAGAGGCGGGCACAGCCGGG + Intronic
1167497572 19:49828565-49828587 AGAGAGAGACCGGCCCGGCCTGG - Intronic
1168489380 19:56795409-56795431 GGCGAGCGGGTAGCCCAGCCAGG - Intronic
925331621 2:3063053-3063075 GGCCAGAGGCTGACTCAGCCAGG + Intergenic
927181391 2:20448622-20448644 GGCGGGAGTCTGGCCCAGCCTGG - Exonic
927843664 2:26460617-26460639 GGGGAGGGGCTGGGCCGGCAGGG + Intronic
927965370 2:27264616-27264638 GAGGAGAGGCTGGCGCAGCCGGG - Intronic
928181495 2:29071640-29071662 CGGGAGAGGCTGGCCCCACCAGG - Exonic
929589765 2:43137361-43137383 GGTGGGAGGGTGGCCTGGCCAGG - Intergenic
931671766 2:64654000-64654022 GGGGAGAGGCGGGCCGGGGCGGG - Intronic
932780123 2:74554332-74554354 GGCTGGGGGCGGGCCCGGCCAGG + Exonic
933779733 2:85793108-85793130 GGGGAGAGGCTGGCTCGTCCAGG - Intergenic
934992607 2:98932244-98932266 GGAGACAGGCCGGCCCGGCCTGG - Intronic
936147755 2:109992623-109992645 GGCTAGAGGCAGGCCCTTCCAGG + Intergenic
936196936 2:110378824-110378846 GGCTAGAGGCAGGCCCTTCCAGG - Intergenic
936662009 2:114553234-114553256 CGGGAGAAGCTGGCCCAGCCTGG - Intronic
938018557 2:127886740-127886762 ATCAAGAGGCTGGCCCGGCCAGG - Intergenic
941376454 2:164737247-164737269 GGGAAGAGGGTGGCCCTGCCAGG + Intronic
944114264 2:196171001-196171023 GGGGAGAGCCGGGGCCGGCCGGG + Intronic
944221885 2:197311005-197311027 GGCCCGGGGCCGGCCCGGCCGGG - Intronic
944270998 2:197785497-197785519 GGCCACAGGCGGGCCCTGCCAGG + Intronic
947119422 2:226799852-226799874 GGCGCGGGGCGGGCTCGGCCCGG - Intergenic
948917033 2:241039630-241039652 GGCGAGAGGCTGGGTGGGGCAGG - Intronic
1168849023 20:964008-964030 TACGAGAGGCTGGCCGGGCTGGG - Exonic
1168876872 20:1177891-1177913 GGCCAGAGGCTGGTCAGGTCAGG - Intronic
1169437972 20:5610696-5610718 GGGCAGTGGCCGGCCCGGCCCGG + Intronic
1169489112 20:6056324-6056346 GGCAAGGGCCTGGCCTGGCCAGG + Intergenic
1172228646 20:33322310-33322332 GGGGAGAGGCAGTCCCAGCCCGG - Intergenic
1173626355 20:44475885-44475907 CGCGAGAGGCCGGGCAGGCCGGG + Exonic
1174287715 20:49484051-49484073 GGCGAGTTGCCTGCCCGGCCGGG - Intergenic
1174352574 20:49979223-49979245 GGGGAGGGCCTGGCCCTGCCGGG + Intergenic
1175399579 20:58692845-58692867 GCCGAGCGGCGGGCCGGGCCGGG + Exonic
1176147619 20:63572464-63572486 GGCAGGAGGCTGGCCGGCCCGGG + Intronic
1176235215 20:64050649-64050671 GGCGAGATTCTGACCCTGCCTGG - Intronic
1179512021 21:41879411-41879433 GGCGAGACCCTGGCGCGGCCGGG + Exonic
1179887957 21:44322449-44322471 GGCGAGCGTCTGTCCCTGCCTGG + Intronic
1180195047 21:46189020-46189042 GGCGAGTGGGAGGCCCAGCCTGG - Exonic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181668056 22:24412039-24412061 GGCAGGAGGCTGGCCTGGCCTGG - Intronic
1182254880 22:29031022-29031044 GGCGAGAGGCCAGGGCGGCCAGG - Intronic
1183459992 22:37944094-37944116 GGCCTGAGGATGGCCCTGCCTGG + Exonic
1183513236 22:38248138-38248160 GGGGAGAGGCTGGCTGGGACAGG - Intronic
1184176587 22:42792653-42792675 GGGGAGTGGCTGGCCTGGCTGGG + Intergenic
1184240418 22:43208858-43208880 GGGGAGAGGCTGGGCAGGGCTGG - Intronic
1184643606 22:45884771-45884793 GGCAAGGGCCTGGCCCAGCCTGG + Intergenic
1184670811 22:46011539-46011561 GGGGAGAGGCTGGGAGGGCCGGG + Intergenic
1185008507 22:48299830-48299852 GGCTTGAGGCTGGCGCTGCCAGG - Intergenic
1185015523 22:48340422-48340444 GGCGTGAGGCTGGCCAGCCCTGG - Intergenic
1185060416 22:48603568-48603590 GGGGAGAGGCAGGCCAGGTCCGG - Intronic
950023771 3:9806976-9806998 GGCAGGAGGAGGGCCCGGCCAGG - Intronic
950570341 3:13795976-13795998 GCCGAGAGCCAGGCCCGGCCAGG - Intergenic
952720016 3:36522827-36522849 GGAGAGAGGCTGGGCTGGGCGGG + Intronic
954409339 3:50363598-50363620 GGCGGAAGGATGGCCCAGCCAGG + Intronic
954785185 3:53087422-53087444 GGTGAGAGGCTGGGCAGGCCCGG - Intronic
961392258 3:126559070-126559092 GCTGAGAGGCTGGCCAGCCCTGG - Intergenic
962520758 3:136195874-136195896 GGCGGGGGGCAAGCCCGGCCGGG + Intronic
963042918 3:141082327-141082349 GATGAGAGCCTGGCCCAGCCTGG - Intronic
968341574 3:197960177-197960199 GGCGAGGGGCGGGGCCGGCGCGG + Intergenic
968512889 4:1003176-1003198 GGCGAGGGGCCGGGCCGGGCCGG + Intronic
968576443 4:1368507-1368529 GGGGAGGGGATGGCCAGGCCTGG - Intronic
969449748 4:7266218-7266240 GGCCAGCGGGTGGCCTGGCCTGG + Intronic
969682668 4:8651991-8652013 GGCAAGAGGCTGGTGGGGCCAGG + Intergenic
970421079 4:15906120-15906142 GGCCAGAGGCCAGCCCCGCCCGG - Intergenic
971244139 4:24913109-24913131 GGCGCGGGGCGGGCCCGGCGGGG - Intronic
972321654 4:37977647-37977669 GGCGAGCGGCGGGCGCGACCAGG + Intronic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
984858659 4:184217753-184217775 GGGCAGAGGCTGGCTGGGCCAGG + Exonic
985711288 5:1431363-1431385 GGTGAGGGGCGGGCCTGGCCTGG + Intronic
987051940 5:14154236-14154258 GGGGAGAGGCTGGCCAGGGAGGG + Intronic
989146907 5:38258451-38258473 GGAGGGAGGCTCGACCGGCCCGG - Exonic
994670270 5:102755165-102755187 GGCGAGCGGCGGACCCGGCTGGG + Intronic
997434877 5:133866916-133866938 GGTGAGAGGCTAGCCCTCCCTGG + Intergenic
997859822 5:137406181-137406203 GGTGAGAGGCTGCCCCTGTCTGG - Intronic
1000004020 5:157166414-157166436 GGGGAGAGGCTGACCCTGCCTGG + Intronic
1002784502 6:391611-391633 GCCGAGAGCCGGGGCCGGCCGGG - Intergenic
1003013843 6:2452031-2452053 GGGGAGAGGCTGGGGAGGCCAGG + Intergenic
1003326213 6:5093328-5093350 GGCCAGGGGCTGTCCCTGCCTGG + Intergenic
1003518752 6:6839621-6839643 GGCGAGTGGCTGGCAGGGCAAGG - Intergenic
1004914251 6:20317667-20317689 GGAGACAGGCAGGCCCGGGCTGG - Intergenic
1005905564 6:30259739-30259761 AGCGAGTGGCCCGCCCGGCCCGG + Intergenic
1006256619 6:32837778-32837800 GAGGAGAGGCAGGTCCGGCCTGG + Exonic
1006491504 6:34392237-34392259 GGCGGCAGGCTGGGCGGGCCGGG - Intronic
1006851628 6:37102767-37102789 GGCGAGGGGCCGGGGCGGCCGGG - Intergenic
1012052569 6:94362404-94362426 GGCTAGAGGGTGACTCGGCCAGG + Intergenic
1013367312 6:109446010-109446032 GAGGAGAGGCTGCCACGGCCTGG + Intronic
1013459037 6:110358072-110358094 GCCGCGCGGCTGGCCCGGCGCGG + Exonic
1013509051 6:110828138-110828160 AAAGAGAGGCTGGCCAGGCCCGG + Intronic
1017282185 6:152637032-152637054 GCCCAGAGGCTGAACCGGCCTGG - Intronic
1017715780 6:157212072-157212094 GGCGGGAGCCTGGGCAGGCCAGG - Intergenic
1018170337 6:161139201-161139223 GGTGGGAGGCTGGACCGTCCAGG + Intronic
1018818564 6:167354942-167354964 AGGGAGACGCTGGCCCTGCCTGG - Intronic
1018892080 6:167989734-167989756 GGCGAGAGGCCGGGAGGGCCAGG - Intergenic
1018940993 6:168308770-168308792 TCCTCGAGGCTGGCCCGGCCAGG - Exonic
1019424437 7:967532-967554 GCGGAGAGGCAGGCCCGACCCGG + Exonic
1019442528 7:1054689-1054711 GGCAAGAGGCTGGCCCCACGCGG + Intronic
1019475685 7:1242975-1242997 GGGGAGGGGGTGGCCCGGCCGGG + Intergenic
1019478437 7:1255180-1255202 GGGGCGGGGCTGGCCTGGCCTGG + Intergenic
1019497556 7:1347565-1347587 AGGGTGAGGCTGGCCCCGCCTGG + Intergenic
1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG + Intronic
1019568036 7:1694346-1694368 GGCGCTGGGCTGGGCCGGCCTGG - Intronic
1019786123 7:2978641-2978663 AGCGAGAGGGCGGTCCGGCCAGG + Intronic
1019828354 7:3301683-3301705 AGCGAGGGGCGGGCGCGGCCGGG - Exonic
1021450337 7:20778272-20778294 GGGGAGCGGCGGGCCCGGGCCGG + Intergenic
1022441412 7:30436364-30436386 GGCAGGAGGCTGGCGAGGCCTGG + Intronic
1024281883 7:47725245-47725267 GGCCAGGAGCTGGCCAGGCCAGG + Intronic
1026048018 7:66921408-66921430 GCCGAGCAGCTGGCCCGGCTGGG + Exonic
1026968553 7:74454606-74454628 GGCCAGGGGCTGGCCCAGACCGG - Intronic
1029111732 7:98216194-98216216 GGCGAGAGGCTGGCCCGGCCCGG - Exonic
1029456729 7:100675522-100675544 GGCGGGAGGCTGGGTCGGGCGGG + Intronic
1029460126 7:100689498-100689520 GGAGGGAGGCTGGCCCGGCTTGG + Intergenic
1029548449 7:101223595-101223617 GGGGTGAGCCTGGCCCGGGCAGG + Intronic
1032406006 7:131655983-131656005 GGCGACAGGCTGGTGCTGCCTGG + Intergenic
1033328414 7:140398268-140398290 GGCGAGCGGCCGACCCTGCCTGG + Intronic
1034222796 7:149459536-149459558 GGTGAGGGGCTGGGCCGCCCTGG - Intronic
1034426933 7:151018885-151018907 GGCGCGCGGCTGGTCCCGCCTGG - Exonic
1035466608 7:159083605-159083627 GGTGAGAAGCAGGCCTGGCCCGG - Intronic
1037644759 8:20783261-20783283 GGCGAGGGGATGGCCCTGCTTGG + Intergenic
1039484250 8:37899036-37899058 GGGGAGGGGAGGGCCCGGCCTGG - Intronic
1039846505 8:41329569-41329591 AGTGAGAGGCTGGCCCTGCCTGG + Intergenic
1039868883 8:41529044-41529066 GGCGGGAGGCTGGTCCGGGTTGG - Intergenic
1041219138 8:55631769-55631791 GGAGAGAGGCTGCCCCTCCCAGG - Intergenic
1042956760 8:74259445-74259467 GGCGAGCGGCCAGCGCGGCCTGG + Exonic
1044698859 8:94949048-94949070 GGCGCGCGGCCGGCCCCGCCGGG + Intronic
1045847682 8:106657571-106657593 GGGGAGGGGCTGGGCGGGCCAGG + Intronic
1048980116 8:139698708-139698730 GGCGAGCACCTGGCCCTGCCAGG - Intronic
1049324477 8:142014907-142014929 GGGGAGAGGCTGGGCAGCCCCGG - Intergenic
1049387616 8:142352106-142352128 AGTGAGAAGCCGGCCCGGCCTGG + Intronic
1049409329 8:142465385-142465407 GGCCAGAGGCTGCAGCGGCCTGG + Intronic
1049778261 8:144416137-144416159 GGGGAGAGGCAGGCCTGGCCAGG + Intronic
1053431192 9:38042828-38042850 GCCCAGAGCCTGGCCTGGCCTGG - Intronic
1056711005 9:88991695-88991717 GGTGAGAGGCGGGCCCGGGCGGG + Exonic
1057234334 9:93346554-93346576 CGGGAGAGGCGAGCCCGGCCGGG - Intergenic
1058967120 9:110048711-110048733 GGCGAGCGGCAGCCCCGGGCTGG - Exonic
1060812700 9:126618998-126619020 GCCGAGAGGCTCGGCCGCCCGGG - Intronic
1061128331 9:128690110-128690132 GCCCAGAGGCTGGCCCCGGCGGG + Intronic
1061177815 9:129008206-129008228 GGGGAGAGCCTGGCCAGGGCTGG - Exonic
1061401863 9:130372975-130372997 GGGGGGGGGCTGGCCCGCCCAGG - Intronic
1061542100 9:131283018-131283040 GGCGCGCCCCTGGCCCGGCCGGG - Intergenic
1061620393 9:131807845-131807867 GGCGAGAGGAGGGGCTGGCCTGG + Intergenic
1061620394 9:131807850-131807872 GAGGAGGGGCTGGCCTGGCCTGG + Intergenic
1061955015 9:133956818-133956840 GGAGGGAGGCTGCCCCTGCCAGG + Intronic
1062268568 9:135698674-135698696 GGCGACAGGCTGTCCAGCCCAGG + Intronic
1062321687 9:135993335-135993357 GGGCAGAGGCTGGCCCGGGAGGG - Intergenic
1062341191 9:136094684-136094706 GGCGAGGCGCGGGCCCGGCTGGG + Intronic
1062443360 9:136583386-136583408 GGCCATGGGCTGGCCCGGGCTGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186660486 X:11664381-11664403 GGCTACTGGCTGGCCCGGCCAGG + Exonic
1188004384 X:25007195-25007217 GGCGGCAGGCTGGCCGAGCCCGG + Exonic
1189160382 X:38804085-38804107 GGCGAGAGGCGGAGCTGGCCCGG + Exonic
1191112842 X:56821215-56821237 TGGGAGAGGCTGGCCAGGCATGG - Intergenic
1195625210 X:106999905-106999927 GGCTGCGGGCTGGCCCGGCCCGG - Exonic
1195923261 X:110002898-110002920 GGCGGGAGGCCGGGCCAGCCGGG - Intronic
1197766179 X:130060634-130060656 GGCGGGAGAGTGGCCCGGCGGGG - Intergenic
1200163289 X:154019863-154019885 GGCGCGGGCCTGGGCCGGCCGGG + Exonic
1200242918 X:154507157-154507179 GGCGACAGGCTGCCCCGGTGGGG + Intronic