ID: 1029112056

View in Genome Browser
Species Human (GRCh38)
Location 7:98217574-98217596
Sequence CCGGTGTCTGGGTTGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112056_1029112074 30 Left 1029112056 7:98217574-98217596 CCTCCCTGCAACCCAGACACCGG 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112056_1029112068 2 Left 1029112056 7:98217574-98217596 CCTCCCTGCAACCCAGACACCGG 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112056 Original CRISPR CCGGTGTCTGGGTTGCAGGG AGG (reversed) Intronic