ID: 1029112059 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:98217577-98217599 |
| Sequence | GACCCGGTGTCTGGGTTGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 115 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 108} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029112059_1029112074 | 27 | Left | 1029112059 | 7:98217577-98217599 | CCCTGCAACCCAGACACCGGGTC | 0: 1 1: 0 2: 0 3: 6 4: 108 |
||
| Right | 1029112074 | 7:98217627-98217649 | CCGTCTTCAGCACCCAGTGCAGG | 0: 1 1: 0 2: 1 3: 23 4: 171 |
||||
| 1029112059_1029112068 | -1 | Left | 1029112059 | 7:98217577-98217599 | CCCTGCAACCCAGACACCGGGTC | 0: 1 1: 0 2: 0 3: 6 4: 108 |
||
| Right | 1029112068 | 7:98217599-98217621 | CCCAGGGGACAGTCCCACAGTGG | 0: 1 1: 0 2: 1 3: 25 4: 227 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029112059 | Original CRISPR | GACCCGGTGTCTGGGTTGCA GGG (reversed) | Intronic | ||