ID: 1029112059

View in Genome Browser
Species Human (GRCh38)
Location 7:98217577-98217599
Sequence GACCCGGTGTCTGGGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112059_1029112068 -1 Left 1029112059 7:98217577-98217599 CCCTGCAACCCAGACACCGGGTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112059_1029112074 27 Left 1029112059 7:98217577-98217599 CCCTGCAACCCAGACACCGGGTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112059 Original CRISPR GACCCGGTGTCTGGGTTGCA GGG (reversed) Intronic