ID: 1029112060

View in Genome Browser
Species Human (GRCh38)
Location 7:98217578-98217600
Sequence GGACCCGGTGTCTGGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112060_1029112068 -2 Left 1029112060 7:98217578-98217600 CCTGCAACCCAGACACCGGGTCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112060_1029112074 26 Left 1029112060 7:98217578-98217600 CCTGCAACCCAGACACCGGGTCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112060 Original CRISPR GGACCCGGTGTCTGGGTTGC AGG (reversed) Intronic