ID: 1029112064

View in Genome Browser
Species Human (GRCh38)
Location 7:98217585-98217607
Sequence TCCCCTGGGACCCGGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112064_1029112068 -9 Left 1029112064 7:98217585-98217607 CCCAGACACCGGGTCCCAGGGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112064_1029112075 26 Left 1029112064 7:98217585-98217607 CCCAGACACCGGGTCCCAGGGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112064_1029112074 19 Left 1029112064 7:98217585-98217607 CCCAGACACCGGGTCCCAGGGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112064 Original CRISPR TCCCCTGGGACCCGGTGTCT GGG (reversed) Intronic