ID: 1029112066

View in Genome Browser
Species Human (GRCh38)
Location 7:98217593-98217615
Sequence TGGGACTGTCCCCTGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112066_1029112074 11 Left 1029112066 7:98217593-98217615 CCGGGTCCCAGGGGACAGTCCCA 0: 1
1: 0
2: 0
3: 55
4: 291
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112066_1029112075 18 Left 1029112066 7:98217593-98217615 CCGGGTCCCAGGGGACAGTCCCA 0: 1
1: 0
2: 0
3: 55
4: 291
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112066 Original CRISPR TGGGACTGTCCCCTGGGACC CGG (reversed) Intronic