ID: 1029112068

View in Genome Browser
Species Human (GRCh38)
Location 7:98217599-98217621
Sequence CCCAGGGGACAGTCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112053_1029112068 25 Left 1029112053 7:98217551-98217573 CCTGGAGGGGATCTGCCTGGGGG 0: 1
1: 0
2: 2
3: 37
4: 380
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112059_1029112068 -1 Left 1029112059 7:98217577-98217599 CCCTGCAACCCAGACACCGGGTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112060_1029112068 -2 Left 1029112060 7:98217578-98217600 CCTGCAACCCAGACACCGGGTCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112056_1029112068 2 Left 1029112056 7:98217574-98217596 CCTCCCTGCAACCCAGACACCGG 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112065_1029112068 -10 Left 1029112065 7:98217586-98217608 CCAGACACCGGGTCCCAGGGGAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112064_1029112068 -9 Left 1029112064 7:98217585-98217607 CCCAGACACCGGGTCCCAGGGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1029112055_1029112068 10 Left 1029112055 7:98217566-98217588 CCTGGGGGCCTCCCTGCAACCCA 0: 1
1: 0
2: 3
3: 28
4: 347
Right 1029112068 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112068 Original CRISPR CCCAGGGGACAGTCCCACAG TGG Intronic