ID: 1029112070

View in Genome Browser
Species Human (GRCh38)
Location 7:98217612-98217634
Sequence GAAGACGGGACGACCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112070_1029112075 -1 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112070_1029112080 24 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112080 7:98217659-98217681 ATAACACAGCCCAAGGCCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1029112070_1029112074 -8 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112070_1029112078 17 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112070_1029112079 23 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112070 Original CRISPR GAAGACGGGACGACCACTGT GGG (reversed) Intronic