ID: 1029112071

View in Genome Browser
Species Human (GRCh38)
Location 7:98217613-98217635
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112071_1029112080 23 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112080 7:98217659-98217681 ATAACACAGCCCAAGGCCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1029112071_1029112078 16 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112071_1029112074 -9 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112071_1029112079 22 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112071_1029112075 -2 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112071 Original CRISPR TGAAGACGGGACGACCACTG TGG (reversed) Intronic