ID: 1029112073

View in Genome Browser
Species Human (GRCh38)
Location 7:98217627-98217649
Sequence CCTGCACTGGGTGCTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112073_1029112078 2 Left 1029112073 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 1
2: 4
3: 29
4: 332
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112073_1029112079 8 Left 1029112073 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 1
2: 4
3: 29
4: 332
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112073_1029112080 9 Left 1029112073 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 1
2: 4
3: 29
4: 332
Right 1029112080 7:98217659-98217681 ATAACACAGCCCAAGGCCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112073 Original CRISPR CCTGCACTGGGTGCTGAAGA CGG (reversed) Intronic