ID: 1029112074

View in Genome Browser
Species Human (GRCh38)
Location 7:98217627-98217649
Sequence CCGTCTTCAGCACCCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 171}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112060_1029112074 26 Left 1029112060 7:98217578-98217600 CCTGCAACCCAGACACCGGGTCC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112056_1029112074 30 Left 1029112056 7:98217574-98217596 CCTCCCTGCAACCCAGACACCGG 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112059_1029112074 27 Left 1029112059 7:98217577-98217599 CCCTGCAACCCAGACACCGGGTC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112065_1029112074 18 Left 1029112065 7:98217586-98217608 CCAGACACCGGGTCCCAGGGGAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112064_1029112074 19 Left 1029112064 7:98217585-98217607 CCCAGACACCGGGTCCCAGGGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112067_1029112074 5 Left 1029112067 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112070_1029112074 -8 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112069_1029112074 4 Left 1029112069 7:98217600-98217622 CCAGGGGACAGTCCCACAGTGGT 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112066_1029112074 11 Left 1029112066 7:98217593-98217615 CCGGGTCCCAGGGGACAGTCCCA 0: 1
1: 0
2: 0
3: 55
4: 291
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171
1029112071_1029112074 -9 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112074 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112074 Original CRISPR CCGTCTTCAGCACCCAGTGC AGG Intronic