ID: 1029112075

View in Genome Browser
Species Human (GRCh38)
Location 7:98217634-98217656
Sequence CAGCACCCAGTGCAGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 338}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112071_1029112075 -2 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112064_1029112075 26 Left 1029112064 7:98217585-98217607 CCCAGACACCGGGTCCCAGGGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112069_1029112075 11 Left 1029112069 7:98217600-98217622 CCAGGGGACAGTCCCACAGTGGT 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112067_1029112075 12 Left 1029112067 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112066_1029112075 18 Left 1029112066 7:98217593-98217615 CCGGGTCCCAGGGGACAGTCCCA 0: 1
1: 0
2: 0
3: 55
4: 291
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112065_1029112075 25 Left 1029112065 7:98217586-98217608 CCAGACACCGGGTCCCAGGGGAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338
1029112070_1029112075 -1 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112075 7:98217634-98217656 CAGCACCCAGTGCAGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112075 Original CRISPR CAGCACCCAGTGCAGGCACA AGG Intronic