ID: 1029112076

View in Genome Browser
Species Human (GRCh38)
Location 7:98217639-98217661
Sequence TATCACCTTGTGCCTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112076_1029112080 -3 Left 1029112076 7:98217639-98217661 CCCAGTGCAGGCACAAGGTGATA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1029112080 7:98217659-98217681 ATAACACAGCCCAAGGCCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1029112076_1029112079 -4 Left 1029112076 7:98217639-98217661 CCCAGTGCAGGCACAAGGTGATA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112076_1029112078 -10 Left 1029112076 7:98217639-98217661 CCCAGTGCAGGCACAAGGTGATA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112076 Original CRISPR TATCACCTTGTGCCTGCACT GGG (reversed) Intronic