ID: 1029112077

View in Genome Browser
Species Human (GRCh38)
Location 7:98217640-98217662
Sequence TTATCACCTTGTGCCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112077_1029112080 -4 Left 1029112077 7:98217640-98217662 CCAGTGCAGGCACAAGGTGATAA 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1029112080 7:98217659-98217681 ATAACACAGCCCAAGGCCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1029112077_1029112079 -5 Left 1029112077 7:98217640-98217662 CCAGTGCAGGCACAAGGTGATAA 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112077 Original CRISPR TTATCACCTTGTGCCTGCAC TGG (reversed) Intronic