ID: 1029112078

View in Genome Browser
Species Human (GRCh38)
Location 7:98217652-98217674
Sequence CAAGGTGATAACACAGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112069_1029112078 29 Left 1029112069 7:98217600-98217622 CCAGGGGACAGTCCCACAGTGGT 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112072_1029112078 3 Left 1029112072 7:98217626-98217648 CCCGTCTTCAGCACCCAGTGCAG 0: 1
1: 0
2: 0
3: 27
4: 415
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112071_1029112078 16 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112073_1029112078 2 Left 1029112073 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 1
2: 4
3: 29
4: 332
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112067_1029112078 30 Left 1029112067 7:98217599-98217621 CCCAGGGGACAGTCCCACAGTGG 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112070_1029112078 17 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1029112076_1029112078 -10 Left 1029112076 7:98217639-98217661 CCCAGTGCAGGCACAAGGTGATA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1029112078 7:98217652-98217674 CAAGGTGATAACACAGCCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112078 Original CRISPR CAAGGTGATAACACAGCCCA AGG Intronic