ID: 1029112079

View in Genome Browser
Species Human (GRCh38)
Location 7:98217658-98217680
Sequence GATAACACAGCCCAAGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112076_1029112079 -4 Left 1029112076 7:98217639-98217661 CCCAGTGCAGGCACAAGGTGATA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112071_1029112079 22 Left 1029112071 7:98217613-98217635 CCACAGTGGTCGTCCCGTCTTCA 0: 1
1: 0
2: 1
3: 6
4: 43
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112070_1029112079 23 Left 1029112070 7:98217612-98217634 CCCACAGTGGTCGTCCCGTCTTC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112077_1029112079 -5 Left 1029112077 7:98217640-98217662 CCAGTGCAGGCACAAGGTGATAA 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112072_1029112079 9 Left 1029112072 7:98217626-98217648 CCCGTCTTCAGCACCCAGTGCAG 0: 1
1: 0
2: 0
3: 27
4: 415
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1029112073_1029112079 8 Left 1029112073 7:98217627-98217649 CCGTCTTCAGCACCCAGTGCAGG 0: 1
1: 1
2: 4
3: 29
4: 332
Right 1029112079 7:98217658-98217680 GATAACACAGCCCAAGGCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112079 Original CRISPR GATAACACAGCCCAAGGCCG CGG Intronic