ID: 1029112156

View in Genome Browser
Species Human (GRCh38)
Location 7:98217933-98217955
Sequence CACCTGGTCCAGGGGCCCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 315}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112142_1029112156 -1 Left 1029112142 7:98217911-98217933 CCCGATACCCCCTGAGCACCCCC 0: 1
1: 0
2: 4
3: 15
4: 234
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112147_1029112156 -10 Left 1029112147 7:98217920-98217942 CCCTGAGCACCCCCACCTGGTCC 0: 1
1: 1
2: 2
3: 33
4: 369
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112143_1029112156 -2 Left 1029112143 7:98217912-98217934 CCGATACCCCCTGAGCACCCCCA 0: 1
1: 0
2: 1
3: 14
4: 273
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112140_1029112156 7 Left 1029112140 7:98217903-98217925 CCCAAGTGCCCGATACCCCCTGA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112146_1029112156 -9 Left 1029112146 7:98217919-98217941 CCCCTGAGCACCCCCACCTGGTC 0: 1
1: 0
2: 0
3: 24
4: 354
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112139_1029112156 8 Left 1029112139 7:98217902-98217924 CCCCAAGTGCCCGATACCCCCTG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112137_1029112156 28 Left 1029112137 7:98217882-98217904 CCAGAGAGGGAACCAGAGCACCC 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112145_1029112156 -8 Left 1029112145 7:98217918-98217940 CCCCCTGAGCACCCCCACCTGGT 0: 1
1: 0
2: 3
3: 32
4: 395
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112141_1029112156 6 Left 1029112141 7:98217904-98217926 CCAAGTGCCCGATACCCCCTGAG 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315
1029112138_1029112156 16 Left 1029112138 7:98217894-98217916 CCAGAGCACCCCAAGTGCCCGAT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG 0: 1
1: 0
2: 4
3: 38
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112156 Original CRISPR CACCTGGTCCAGGGGCCCCA CGG Exonic
901075935 1:6554650-6554672 GATCTGGTCGAGGGGCTCCACGG + Intergenic
901828777 1:11879652-11879674 GAACTGGCCCAGGGGCCCCCTGG + Intergenic
902620079 1:17645703-17645725 CACCTTGTCCCGGGGCAGCACGG - Intronic
903369696 1:22827240-22827262 CACATGTTCCAGGGGCTCCGAGG - Intronic
903996463 1:27307990-27308012 CAGCTGGTCCTTGGGCCCCAGGG - Exonic
904611430 1:31728113-31728135 GACCTGGTGCAGTGGCCCCTGGG - Intronic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905211722 1:36378963-36378985 CACCAGGCCCAAGGTCCCCAAGG + Intronic
905674441 1:39815917-39815939 CACCTGGCTCAGTGGCTCCAGGG - Intergenic
905733505 1:40311697-40311719 CATCTGGTCCAGGGTCCCCCTGG + Exonic
906057936 1:42930656-42930678 CAGCTGGTGCAGGGTGCCCAGGG + Exonic
907258310 1:53196967-53196989 CGCCTGGCCCCGGGGCCCCGCGG + Exonic
907500492 1:54876009-54876031 CACCTGGCCCATGGTCACCAAGG + Exonic
908355388 1:63322313-63322335 CACCCGCTCCCTGGGCCCCAGGG + Intergenic
908525228 1:64981426-64981448 CACCTGGCCCAGTGCCTCCAGGG + Intergenic
913114659 1:115685076-115685098 CATGTGGAACAGGGGCCCCAGGG - Intronic
913260201 1:116990855-116990877 CAGCTGTTCCAGGGGCCCGCAGG - Intergenic
915280387 1:154818424-154818446 CACCTAGTGCAGGAACCCCAGGG - Intronic
915489164 1:156241986-156242008 CTGCTGGGCCAGGGGCCCCTGGG - Exonic
915934422 1:160082382-160082404 CACAGGGTCCAAGAGCCCCATGG - Intronic
917669303 1:177257284-177257306 CAGCTGGTGCAGGGTCTCCAGGG - Exonic
920121827 1:203664646-203664668 GCCCGGGTGCAGGGGCCCCACGG + Intronic
920560064 1:206932514-206932536 CACCAGGCCCAGGGGCACCAGGG + Exonic
922702757 1:227771462-227771484 CACCTGGTCCAGGGCGCCCCTGG - Intronic
1066957422 10:42186234-42186256 CACCAGGTGCAGGTGCACCATGG - Intergenic
1067068672 10:43117454-43117476 CACCTGGTCCAAGGGGTCCTGGG + Intronic
1069557856 10:69409137-69409159 CGCCTGGTCCTGGGACCCCGCGG + Intronic
1069632000 10:69902789-69902811 CACTTGGTCCAGGGGGGCCTGGG - Exonic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1071356368 10:84800308-84800330 CAACTGGCACAGGGGCTCCAAGG - Intergenic
1073196233 10:101694479-101694501 CACCTGGGCCAGGCGGCCGAGGG + Exonic
1073331504 10:102672961-102672983 CACCTGGGGCAGGGAACCCAGGG + Intergenic
1076042017 10:127258504-127258526 CACTTGGTCCAGGCGTACCATGG - Intronic
1076132827 10:128025757-128025779 GACCTGCTCCAGGGGACCCAGGG + Intronic
1076133525 10:128029420-128029442 CACCTGCTTCAGACGCCCCATGG - Intronic
1076679202 10:132163040-132163062 CAGAAGGACCAGGGGCCCCACGG - Intronic
1076870101 10:133188811-133188833 CACCTGAACCAAGGGACCCAGGG + Intronic
1077008484 11:369897-369919 CACCTGGGCCTGGTGCGCCAGGG + Exonic
1077175830 11:1190008-1190030 CACTTGGTCCAGGTGCACCGGGG - Intronic
1077321021 11:1942042-1942064 CACCTGCTCCTGGTGGCCCAGGG - Intergenic
1077436050 11:2539724-2539746 CGCCTGCTGCAGGGGCCCCCAGG + Intronic
1077473899 11:2777485-2777507 CCCCGTGTCCAGGGGACCCAAGG - Intronic
1077539751 11:3140903-3140925 CACCTGGCCCCAGGGCCCCCTGG - Intronic
1078108633 11:8374201-8374223 CACCTGCCCCAGGGTCCACAGGG + Intergenic
1079111228 11:17606249-17606271 CTCCTGGCACAGGGGCCACATGG + Intronic
1081570700 11:44289074-44289096 CAAGTGTTCCAGGGTCCCCAGGG + Intronic
1081619656 11:44611774-44611796 CACCTGGGCCACGGGGACCATGG - Intronic
1081812757 11:45922709-45922731 CACCTGCTCCAGCGGCTCCCGGG - Intronic
1082043531 11:47706620-47706642 CACCTAGTCCAGAGGCTGCAGGG + Intronic
1083474692 11:62908489-62908511 CACCTGAGCCAGGGACTCCACGG + Intergenic
1083998719 11:66284629-66284651 CACCTGGTCCGGTGACCCCCTGG - Exonic
1084515660 11:69636958-69636980 CACGGGCTCCAGGGACCCCAGGG + Intergenic
1085529324 11:77182254-77182276 GACCTGGTCCCTGGCCCCCAGGG - Intronic
1088536354 11:110866370-110866392 CACCTGGGCCAGTGGGCACAGGG + Intergenic
1089297721 11:117480170-117480192 TCCCTGGGCCAGGGTCCCCAAGG - Intronic
1089540798 11:119188075-119188097 CACCTGGAGAAAGGGCCCCAGGG + Exonic
1089566669 11:119375421-119375443 CACCTGGCCCAGGGGGCCCCTGG + Intronic
1089643815 11:119864966-119864988 CACATGGCCCAGGGGCACCAGGG + Intergenic
1091256591 11:134192796-134192818 CAGCTGGTCCAGGAACTCCAGGG + Exonic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1092531727 12:9350644-9350666 CAGCAGGCCCATGGGCCCCAGGG - Intergenic
1094840132 12:34339367-34339389 CACGGGGTCCAGGGGACCCTGGG + Intergenic
1094852891 12:34390163-34390185 CACATGGCCCAGGGGACCCTGGG + Intergenic
1094854979 12:34398877-34398899 CACGTGGCCCAGGGGACCCTGGG + Intergenic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096089629 12:48890266-48890288 CAGCTCATCCACGGGCCCCAGGG - Intergenic
1096228170 12:49882471-49882493 CCCCTGCCCCATGGGCCCCAGGG + Intronic
1096627821 12:52906156-52906178 CACCTGGCCCAGGGGATCCTAGG - Intronic
1096845673 12:54405176-54405198 ATCCTGGTCCAGGTCCCCCAGGG + Exonic
1097233529 12:57525860-57525882 CCCCTGGTCCTGGGGCCCCTGGG + Exonic
1102295092 12:111730256-111730278 GACCTGGTCCAGTGTTCCCAGGG + Intronic
1102471906 12:113164032-113164054 CCCCAGGTCCAGGGTCCCCAGGG + Intronic
1102908868 12:116697412-116697434 CACCTGGAGCAGGGACCTCATGG - Intergenic
1102959775 12:117085044-117085066 CAGCTGGCCAAGGGGCACCAGGG + Intronic
1103910565 12:124349826-124349848 CACTCGGTCCAGGGGCACCAGGG + Intronic
1103923090 12:124409634-124409656 CACATGGTCCAAGTTCCCCATGG + Intronic
1104055685 12:125228298-125228320 CACGTGGTCCTGGAGCCCCGGGG - Intronic
1104078718 12:125411955-125411977 AAACAGGTCCAGGGGACCCAAGG - Intronic
1104348318 12:128022615-128022637 CTCCTTGTCCATGGGCCCCAAGG + Intergenic
1104647604 12:130508453-130508475 CAGCAGGTGCAGGGGCCCCGGGG - Intronic
1104897379 12:132171052-132171074 CAACAGCTCCACGGGCCCCAGGG - Intergenic
1104924279 12:132305965-132305987 CACCTGGGCCGGGGGGCTCACGG + Intronic
1104970326 12:132528024-132528046 GACCTGGTCCTAAGGCCCCAGGG - Intronic
1105627796 13:22129979-22130001 CTTCTGCTCCAGGGGCACCAGGG - Intergenic
1106035169 13:26037620-26037642 CAGCTGGTCCTGGTGCCCCACGG - Intergenic
1107692773 13:42968569-42968591 CACCTGCTCCAGAGGCCCAGAGG + Intronic
1108500510 13:51065964-51065986 CAGCTGCTCCTGGGGCCACAGGG + Intergenic
1108775215 13:53757504-53757526 CACCAGGGCCAGGGACCACATGG + Intergenic
1112380112 13:98880914-98880936 CACCTGTGCCAGGGGCTTCAAGG + Intronic
1112549797 13:100409053-100409075 CACATGGTCCAAGGGCACCCGGG - Intronic
1113522251 13:110949347-110949369 CACCTGCTGCACGGTCCCCACGG + Intergenic
1113795100 13:113052303-113052325 CACCTGGTCCCAGGGACCCCCGG - Intronic
1114219568 14:20684428-20684450 CACCCGCCCCAGGGGCCGCAGGG - Exonic
1114902698 14:27084618-27084640 CACCTGTACCAGTGACCCCATGG - Intergenic
1118761668 14:68884111-68884133 AGCATGGGCCAGGGGCCCCAGGG + Intronic
1122302808 14:100740726-100740748 CACCTGCTCCAGGTGCTGCACGG - Intergenic
1122579865 14:102764730-102764752 CACCTGGGCCGGGGGCCACAGGG + Intergenic
1122651039 14:103227251-103227273 CTGCTGGTCCAGAGCCCCCAGGG + Intergenic
1122660749 14:103293394-103293416 CACCTGGGCCAGGGAGGCCAAGG + Intergenic
1122889472 14:104725704-104725726 CACCTTGTCCTGGGCCGCCAGGG + Intronic
1122977092 14:105175203-105175225 CACCTCCTCCAGGGGGACCAAGG + Intronic
1123112737 14:105880759-105880781 CACCAGGGCCAGGGTCCCCCAGG + Intergenic
1123115829 14:105893652-105893674 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123117857 14:105902762-105902784 CAGCTGAGCCAGGGGCCCCCAGG + Intergenic
1123120071 14:105912367-105912389 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123402809 15:20003953-20003975 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123512146 15:21010607-21010629 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1124892841 15:33748661-33748683 CACCTTGTGCAGAGGCCACAGGG + Intronic
1128390987 15:67182439-67182461 GACCTTGTCCTGGAGCCCCAAGG + Intronic
1128766153 15:70252433-70252455 GCCGTGGTCCAGGGGCCTCACGG - Intergenic
1128939583 15:71777456-71777478 CGCCTGGGCCAGGGGGCCCGTGG - Exonic
1130297989 15:82660584-82660606 CACATGATCCAGGCCCCCCATGG + Intronic
1131256047 15:90863126-90863148 AGCCTGGTCCATGTGCCCCAGGG + Intergenic
1131510516 15:93047362-93047384 CCCTTGGTCCAGGGGGACCAAGG - Intronic
1132224788 15:100132064-100132086 CACATGCTCCAGGCGCCCCACGG + Exonic
1132671643 16:1104355-1104377 CAGCTGGTGCAGGAGCCTCAGGG - Intergenic
1132762978 16:1519943-1519965 CTCCTGGTCCAGGGGGCTCTTGG + Exonic
1133975082 16:10594855-10594877 CACCTGGACCTGGGGCACCTGGG - Intergenic
1134094629 16:11411369-11411391 CACCTTGTCCAGTGCCCCCAGGG + Intronic
1134632310 16:15765675-15765697 GAGCTGGGCCAGGGACCCCATGG - Intronic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136618524 16:31412935-31412957 CACCTGGCCCCGGGCCCCCACGG - Exonic
1137566048 16:49533079-49533101 CATCTGGTCCAGGCCCACCAAGG + Intronic
1137724077 16:50645403-50645425 CAGCTGGTACAAGGGCCTCAAGG + Intergenic
1138376117 16:56565119-56565141 CACCTGGACCATGGACCCCAGGG + Exonic
1138515408 16:57533253-57533275 CACCCGCTCCAGGGGACCCTGGG - Intronic
1139594377 16:67949565-67949587 CACCTGCTCTGGGGGCCTCAGGG + Intronic
1139955587 16:70691548-70691570 CACCTGATGCAGTGTCCCCAGGG - Intronic
1140116380 16:72045014-72045036 CACCAGGACCAGGGGCTACAGGG - Intronic
1140135356 16:72200876-72200898 CACCTGGTCCAGTGCTGCCAGGG + Intergenic
1140218882 16:73029196-73029218 CACCTGCTCCTGGGACCCCAAGG + Intronic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1140887537 16:79258324-79258346 CACCTGCTCCATGGGGACCAGGG + Intergenic
1141627369 16:85268430-85268452 CACCTGGGGCAGGGGCCAGACGG - Intergenic
1141695283 16:85616200-85616222 TACCTGCTCCAGGGGCTCAAGGG - Intronic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142201486 16:88763053-88763075 CACCCTGTCCAAGTGCCCCAGGG - Intronic
1142237320 16:88928322-88928344 CACCTGGTCATCGGCCCCCAAGG - Intronic
1142432583 16:90037984-90038006 AAGCTGGTCCAGGGGCCACAAGG - Intronic
1143136666 17:4716199-4716221 CCCCAAGTCCAGGGGGCCCAGGG + Intronic
1143375514 17:6464597-6464619 CACCTGCACCAGGTGCCTCATGG - Intronic
1143625877 17:8109913-8109935 CACCTGGTCCACGAGGCCCTCGG + Exonic
1144677330 17:17170295-17170317 CTCCTGGTCCTCAGGCCCCAAGG - Intronic
1144967472 17:19087078-19087100 CACCTGGGCCCGGGGGCTCAAGG + Intergenic
1144980447 17:19164989-19165011 CACCTGGGCCCGGGGGCTCAAGG - Intergenic
1144987775 17:19213244-19213266 CACCTGGGCCCGGGGGCTCAAGG + Intergenic
1145037499 17:19551545-19551567 CTCCAGGACCAGGGACCCCAGGG + Intronic
1145208064 17:20995147-20995169 CCCCTGGCCCATGGGACCCAGGG - Intergenic
1146128989 17:30253700-30253722 AACCTGCTCCAGGGATCCCAAGG + Intronic
1146654128 17:34625374-34625396 CAGCTGGTGTAGGGTCCCCAGGG - Intronic
1147612527 17:41810489-41810511 CCCCTGCTCGAGGGACCCCAGGG + Intronic
1147882852 17:43665270-43665292 CATCTGGCCCAGGGACCTCATGG + Intergenic
1148700453 17:49583571-49583593 CACCTGGTCAGGTGGTCCCAAGG + Intronic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1149661889 17:58338363-58338385 CACCTCTTCGAGGGGTCCCAGGG + Intergenic
1150934304 17:69618490-69618512 CATCTTGTCCAGAGGCCTCATGG - Intergenic
1151977539 17:77490999-77491021 CACCTGGGCCAGGGACCACCAGG - Intronic
1152251798 17:79216357-79216379 CACCTGCTCCGTGGTCCCCATGG - Intronic
1152710130 17:81867256-81867278 CACGTGCGCCAGGGGCCACAAGG + Intergenic
1154309398 18:13255559-13255581 CACCTGGACCCTGGGCCCTATGG - Intronic
1156223200 18:35075222-35075244 CACCTGCACCACGGGTCCCAGGG - Intronic
1157201433 18:45663231-45663253 CTACTGGTCCAGGGACCACAGGG + Intronic
1160235472 18:77082679-77082701 CACCTGGTCCAGCTGCTGCAGGG - Intronic
1160238989 18:77109118-77109140 CACCAGGTCCAGGGTTCCCTGGG + Intronic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161994395 19:7703624-7703646 CACCTGGTCCAGGGGGAAGAGGG - Intergenic
1163234338 19:16022286-16022308 CCCCTGGCCCATGGGACCCAGGG - Intergenic
1163490888 19:17616662-17616684 CTCCTGCTCCAGGGACACCAGGG + Intronic
1163738445 19:18995954-18995976 CTCCTCCTCCAGAGGCCCCAGGG - Intronic
1164708671 19:30339241-30339263 CACCTGGCCCATGGGCCCTGTGG - Intronic
1165108213 19:33486767-33486789 CAGCTGGACCAGGGTCCCAAGGG + Intronic
1165175905 19:33929556-33929578 CACCTGGGCCAGGGGCCGCACGG + Intergenic
1166281328 19:41796285-41796307 CACCAGGTTCAGGGACCCCAGGG + Intergenic
1166998203 19:46729897-46729919 CAGCTGGGCCAGGGCCCCCTGGG + Intronic
1167271481 19:48508967-48508989 CACCTGGTCAAGGGGCACCCAGG + Exonic
1167703484 19:51065047-51065069 CACTAGGGCCAGGGGCCACATGG + Exonic
1168287789 19:55343019-55343041 CTCCTGCTCCAGCGGCACCACGG - Intronic
1168341299 19:55624481-55624503 CACCAGGTCCAGTGGCTCCTGGG + Exonic
1168353176 19:55687855-55687877 CACCGGGTCCAGGGGCCCCCAGG - Intronic
925084702 2:1099142-1099164 CACCTGGTCCAGCAGCTCCTGGG + Intronic
926280046 2:11438660-11438682 CACCTGGTCCAGCGTGCCAATGG - Intergenic
926953675 2:18271548-18271570 CACCTGCTCCAGGGGCCTGAAGG + Intronic
927283122 2:21328216-21328238 AACCTGATGCAGAGGCCCCAGGG + Intergenic
929818879 2:45257928-45257950 CACATGGTCCAGCGGCTCAAAGG + Intergenic
932558137 2:72843493-72843515 CACCTCTCCCAGGTGCCCCAAGG + Intergenic
932574318 2:72954505-72954527 CAGCTGTTGCAGGGGCCCCTGGG - Intronic
933759925 2:85666096-85666118 CACCTGAACCTGGGGGCCCATGG + Intronic
935597978 2:104894598-104894620 CTCCTGACCCAGGTGCCCCATGG + Intergenic
936118567 2:109722163-109722185 CACCAGGTCCTGGGGCCCTGCGG + Intergenic
937302400 2:120851400-120851422 CCCCTGGCCCTGGGGGCCCACGG - Intronic
941489869 2:166129983-166130005 CACCTGGTCCTGAGTCCCCATGG - Intergenic
942198872 2:173551048-173551070 CAGCTGGTACAAAGGCCCCAAGG + Intergenic
946188069 2:217992391-217992413 CACCTGCTCCAGAGCCCCCTGGG + Intronic
948078953 2:235189824-235189846 CACCTGGACCAGCAGCCCTAGGG + Intergenic
948795730 2:240401253-240401275 CCCATGGTGCAGGGGTCCCATGG - Intergenic
948804736 2:240448583-240448605 CACCTGCTCCAGGACCCGCAGGG + Intronic
1170274994 20:14575518-14575540 CATGTGGTCCAGGGACCCCTGGG - Intronic
1170897360 20:20427639-20427661 CACCTGCTGCAGTGGCCCCTCGG + Intronic
1171465360 20:25324150-25324172 CTCCAGGTCTAAGGGCCCCATGG - Intronic
1172274189 20:33670856-33670878 CACCAGGTCCAGGGTCCCAAAGG + Intronic
1172518869 20:35554597-35554619 CAGTTGGTACAGGGTCCCCATGG + Intronic
1173613111 20:44385332-44385354 CACTTGGGCCAGGTGCTCCATGG + Intronic
1173835933 20:46125669-46125691 GACCTGGTCCAGGTGGCCCCAGG - Intronic
1174193645 20:48757742-48757764 GAGCTGGTCCAGGGGCTACACGG - Intronic
1174476885 20:50801969-50801991 CACCAGGGCCTGGGTCCCCAGGG + Intronic
1174559236 20:51418070-51418092 CACCCAGGACAGGGGCCCCAGGG - Intronic
1174584553 20:51597955-51597977 CACGTGGTCTAATGGCCCCAGGG + Exonic
1175249970 20:57603345-57603367 CACCAGGGCCTGGGGACCCAGGG + Intergenic
1175268231 20:57715264-57715286 CACCGAGTCCAGGGGCCGCTGGG - Intergenic
1175297574 20:57919586-57919608 CACTTGGGCAAGGAGCCCCATGG - Intergenic
1175687720 20:61043825-61043847 GACGAGGTCCAGGGGCCCCGTGG + Intergenic
1175879076 20:62246212-62246234 CACAGCGTCCCGGGGCCCCATGG - Intronic
1175891988 20:62319772-62319794 CGCCTGGTCTCGGGTCCCCACGG + Exonic
1176117697 20:63440207-63440229 CTCCTGGAGCAGGGACCCCAGGG + Intronic
1176366945 21:6039126-6039148 CACCTGCTGCAGGGGCCCCGGGG - Intergenic
1177037292 21:16060179-16060201 CACCTGGTCCAGCTGCAGCAGGG - Intergenic
1178440173 21:32592341-32592363 GTTCTGGTCCAGGGGTCCCAAGG + Intronic
1178614062 21:34114964-34114986 CACTTGGTGCAGGGGCCCCTTGG + Intronic
1179551297 21:42145640-42145662 AACCTGGGCCAGAGGGCCCATGG - Intergenic
1179756573 21:43499420-43499442 CACCTGCTGCAGGGGCCCCGGGG + Intergenic
1180080851 21:45486956-45486978 GTCCTGGTCCTGGGGGCCCAGGG - Exonic
1180122869 21:45765550-45765572 CACCAGTCCCAGGAGCCCCACGG - Intronic
1180751589 22:18128351-18128373 TTCCTGGTCCTGGGGCCCCAGGG - Intronic
1180943986 22:19679683-19679705 CACCTGCTCCAGAGGACGCATGG + Intergenic
1181491529 22:23263269-23263291 CACCTGGGCCAGGCGGCCGAGGG - Intronic
1181609587 22:24003728-24003750 CAGATGGTGCAAGGGCCCCAGGG + Intergenic
1181674928 22:24445198-24445220 CCCCTGCTCCTGGGGCCGCAGGG + Intergenic
1181865549 22:25851800-25851822 CAGCTGGTCCAGATGCCCCCTGG - Intronic
1182085695 22:27559880-27559902 CACCGGATCTAGGGTCCCCAGGG + Intergenic
1182177219 22:28303021-28303043 CACCAGCTCCTGGGGACCCAGGG - Intronic
1183324673 22:37184781-37184803 CAGCTGGTGCAGGGGCCCTGGGG - Intronic
1184614924 22:45631516-45631538 CACCAGGCCCAGGGTGCCCAGGG + Intergenic
1184823336 22:46929853-46929875 CACCAGGTCCAGGGGACCGTTGG - Intronic
1185118790 22:48953188-48953210 CACTTGGGCCAGGGCCCCGAAGG + Intergenic
1185389076 22:50549158-50549180 CACCTGGGTCAGGGGCCGCCAGG - Exonic
949397811 3:3633881-3633903 CAACTAGTCCAGAGGCCCAAAGG - Intergenic
949584636 3:5425653-5425675 TAGCTGGCTCAGGGGCCCCAGGG + Intergenic
949838151 3:8291660-8291682 CACCTGGAGCAGAGGCCCAAAGG + Intergenic
950522539 3:13505484-13505506 CACCTGGGTCAGCGGCCCCCTGG - Exonic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
950667624 3:14506772-14506794 CCACTTGTCCAAGGGCCCCAAGG + Intronic
950702449 3:14759740-14759762 CTCCTGCTCCAGGGGCCCTTGGG - Intronic
952901513 3:38114716-38114738 CAACTGTGCCAGGGGCCCCAGGG - Intronic
953409824 3:42684430-42684452 GACAAGGTGCAGGGGCCCCATGG + Intergenic
953698927 3:45181166-45181188 CAGCTGGCCCAGGGCCCCCCTGG + Intergenic
954108719 3:48422661-48422683 CTCCTGGCCCAGGGGTCACAGGG + Intronic
954136375 3:48583935-48583957 CACCTGGTCCAGGGGGACCCTGG + Exonic
954363724 3:50135528-50135550 TACCTGATCCTGGAGCCCCAGGG - Intergenic
956786537 3:72647518-72647540 CAGCAGGTGCAGGGGTCCCAAGG + Intergenic
959951617 3:112185570-112185592 CACCTGTGCCCGGGGTCCCAGGG + Intronic
962367212 3:134794597-134794619 CACTTGCTCCAGGGTCCACAGGG - Intronic
962462215 3:135624872-135624894 CACCTGTGCCAGAGGCCACATGG + Intergenic
962828445 3:139119593-139119615 CTCCTGGTTCTGGTGCCCCAGGG + Intronic
962945480 3:140165428-140165450 CTCCCGGTCAAGGGGCCTCAGGG + Intronic
964569277 3:158094728-158094750 CCCCTGCTCCAGGGTCTCCAGGG + Intergenic
967894105 3:194383093-194383115 CGAGTGGTCCAGGGGCCCCGGGG + Intergenic
968664962 4:1816014-1816036 CACCAGGTCCAGGGTTTCCACGG + Intronic
968704835 4:2072992-2073014 CACCTGTTCCAAGGACTCCATGG + Exonic
968931421 4:3581538-3581560 GCCCTGGTCCTGCGGCCCCATGG + Intronic
968969225 4:3784756-3784778 CACCTGTCCCAGGGGCCCGTCGG - Intergenic
969657619 4:8507249-8507271 CGCCTGGTCGGGGGCCCCCATGG - Intergenic
970103078 4:12547425-12547447 TACCTGCTCCAGTGCCCCCAAGG + Intergenic
970166904 4:13248053-13248075 CACCTGTTCAAGTGCCCCCACGG + Intergenic
972733704 4:41819461-41819483 GCCCTGGGCCAGGGGACCCATGG + Intergenic
977962094 4:103097998-103098020 CACTTGGTCCAAGGTCCACATGG + Intronic
979690716 4:123555592-123555614 ACCCTGGTGCAGGGGCCCCGCGG + Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
982090591 4:151876782-151876804 CACCTGGGCCAGGTGCTCCCCGG + Intergenic
984555964 4:181214078-181214100 CACAGGGGCCAGGGGCACCAAGG - Intergenic
985163606 4:187069627-187069649 CACATGGCCCAGCGACCCCATGG - Intergenic
985580629 5:693653-693675 CACCTGGCTCTGGGGCCCCCCGG + Intergenic
985704048 5:1390495-1390517 GCCCTCGTCCAGGGGCCCCTGGG - Intergenic
985723676 5:1504346-1504368 CACCTGGTCCCGGGGCTCCAGGG + Intronic
985797492 5:1973824-1973846 CACCAGCACCTGGGGCCCCAGGG - Intergenic
986132246 5:4942402-4942424 CTCCTGGCCCAGGGTCCTCAGGG - Intergenic
986145231 5:5071557-5071579 CCCCTGCTCCAGGAGCCCCCAGG - Intergenic
987131221 5:14861816-14861838 CATCTGGTTCAGGGTCCCTAGGG - Intronic
987387220 5:17341679-17341701 GACTTGGTCCAAAGGCCCCAAGG + Intergenic
987623484 5:20367015-20367037 CACATGGTCCTGTGCCCCCAGGG + Intronic
991183251 5:63778921-63778943 AACTTGTTCTAGGGGCCCCAGGG + Intergenic
991655666 5:68901796-68901818 GAACTGGTACAGGGGACCCAAGG - Intergenic
991711728 5:69415214-69415236 CACCTGGGCCGGGGGCCGCCGGG - Intronic
992124478 5:73626410-73626432 CACTTTCTCCAGGGTCCCCAGGG + Intronic
997422112 5:133778046-133778068 CAGCTGGTCAGTGGGCCCCAAGG + Intergenic
997825057 5:137098841-137098863 CACCGGGTCCACAGGCTCCACGG + Intronic
998483976 5:142485799-142485821 CACCTGGGCCAGGTGCAGCAGGG - Intergenic
1001700802 5:173705409-173705431 CCCCTTCTCCAGCGGCCCCACGG - Intergenic
1002305025 5:178278217-178278239 GGCATGGTCCAGGGGCCACAGGG - Intronic
1002311893 5:178319966-178319988 AAGCTGGTGCAGAGGCCCCAAGG - Intronic
1002355713 5:178627234-178627256 CACCCGGTCCCGGGGCCTCTAGG + Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1002845467 6:940779-940801 CACCTTGTCCAGAGGGCCCCGGG - Intergenic
1004170465 6:13291873-13291895 CTGCTGCTCCAGGGGCCCCCTGG - Intronic
1005419689 6:25636033-25636055 CACCAGGATCAGGGGACCCATGG - Intergenic
1006295669 6:33168963-33168985 CACCTTCTCCAGGGGGGCCAGGG + Exonic
1006472456 6:34236555-34236577 TCCCTGGTACAGGGGTCCCAGGG - Intergenic
1014491117 6:122063197-122063219 CACCTGTAACAGGAGCCCCAGGG + Intergenic
1016919016 6:149272887-149272909 CTCATGCTCCAGTGGCCCCAGGG - Intronic
1017615242 6:156240368-156240390 CTCCTGGGCCAGGGACCCAAAGG - Intergenic
1018219366 6:161562938-161562960 CACCTGGACCAAGGACACCAGGG - Intronic
1018953769 6:168394685-168394707 CCCCAGGTCCAGGTGCCACAGGG - Intergenic
1019197081 6:170289316-170289338 CACCTCGCCCCGGGGCCCCGCGG - Intronic
1019306517 7:337907-337929 CCGCTGGTCCAGGGGCCCTCGGG - Intergenic
1019306534 7:337973-337995 CCGCTGGTCCAGGGGCCCTCGGG - Intergenic
1019433096 7:1008395-1008417 CGCTTGGCCCAGGGGACCCAAGG - Intronic
1019540561 7:1549416-1549438 CACCTGGGCCAAGGGGACCAAGG - Intronic
1022529393 7:31057589-31057611 CTCCTGGGCCAGGGGCCTCCCGG - Intronic
1023354008 7:39349401-39349423 TACGTGGTCCAGGGGCACCCTGG - Intronic
1023866623 7:44241498-44241520 CACCTGGCCCAGGGCCCCTCTGG + Intronic
1025010115 7:55389925-55389947 CTCCTGGTTCTGGGGCCTCATGG + Intronic
1028508794 7:91598995-91599017 CAGCTGGTGCAGAGGCCCCAAGG + Intergenic
1028556798 7:92134177-92134199 CACCTGGTCCAGCTGCCCGCAGG - Exonic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029487449 7:100852365-100852387 CACCTGGGCCAGGTGCGTCACGG - Intronic
1032397731 7:131602598-131602620 CACCTGCACCATGGGCCCTACGG - Intergenic
1033446420 7:141426412-141426434 CAACTGCTCCAGGAACCCCAAGG + Intronic
1034785941 7:153925700-153925722 CACATGGTAGAGGGTCCCCAAGG + Intronic
1034825514 7:154258671-154258693 CCCCTGTTCCAGGGGCCCTGAGG - Intronic
1035297957 7:157877490-157877512 CACTTGGACCCGGGGCCCCGAGG - Intronic
1035751930 8:2002373-2002395 CGCCTGGCGCAGGGGCCTCACGG - Exonic
1036936135 8:13004277-13004299 CACCTGGTCCACGGGCTCTGAGG - Intronic
1039612862 8:38932926-38932948 CTCCAGGCCCAGGGACCCCAGGG - Intronic
1041439398 8:57877726-57877748 CAGCTGGTCCTGGGGCCCAAAGG - Intergenic
1046917234 8:119690805-119690827 ATCCTGGTCCTGTGGCCCCATGG - Intergenic
1047990073 8:130276972-130276994 CACATGGACAAGGGACCCCAGGG - Intronic
1048329141 8:133460486-133460508 CATCTGGTCCAGGCGCCCTCAGG + Intronic
1049093629 8:140535089-140535111 CAGCTGCTGCAGGGGCCGCATGG - Intronic
1049297210 8:141848520-141848542 CACCTGCTGCAGGAGCTCCAGGG - Intergenic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1051534664 9:18143255-18143277 AACTTGGTCCAGAGGCTCCATGG - Intergenic
1052742071 9:32402979-32403001 GACCTGGTCTTGGGGCCCCCTGG + Intronic
1052860927 9:33437239-33437261 CACCCAGTACAGGGACCCCAGGG - Intergenic
1053484370 9:38441045-38441067 CACCTGGGCCAGGGAGACCAAGG - Intergenic
1054458708 9:65450391-65450413 GCCCTGGTCCTGCGGCCCCATGG - Intergenic
1056024781 9:82482504-82482526 CACCTAGTGCAGGTGACCCAGGG + Intergenic
1056764731 9:89437653-89437675 CCTCTGGTCAAGGGGTCCCAGGG + Intronic
1057708099 9:97412219-97412241 CACCTCGTTCCGGGGGCCCACGG - Exonic
1059436083 9:114277242-114277264 CACCTAATCCACGGGTCCCAAGG - Intronic
1060599725 9:124869668-124869690 CACCGGGTCCAGGGGCCTGCGGG - Intronic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061319056 9:129816175-129816197 CAGCACGTCCAGGGGCCCGAGGG - Intronic
1061422573 9:130480212-130480234 CACCTAGTCCAGGTGCCCACTGG - Intronic
1061633076 9:131885903-131885925 CACCTGGTCAATGGGCCTCTGGG + Intronic
1061818293 9:133208833-133208855 CACCTGGTGCTGGGGCCCGGGGG - Intronic
1062014676 9:134285109-134285131 CACCTTGTCCTGGGGCCCCAGGG - Intergenic
1062242159 9:135546525-135546547 CACCTGGTGCTGGGGCCCGGGGG + Intronic
1062474057 9:136718951-136718973 GGCCTGGTCCAGGGGCCCGGAGG - Intronic
1062555048 9:137110064-137110086 CTCCTGGACCAGGTGCCCCATGG + Intergenic
1062682105 9:137787691-137787713 CGCCTGGGCCAGGGGCCGCCAGG + Intronic
1185478828 X:431049-431071 TGCCTGGTCCAGGGTTCCCAGGG - Intergenic
1185926289 X:4150521-4150543 TCCCTGGGCCAGGGGCTCCAAGG + Intergenic
1191902872 X:66056772-66056794 CAGCTGGGCCTCGGGCCCCAGGG - Intergenic
1195038583 X:100992817-100992839 CTCCTGTCCCAGGGTCCCCAGGG - Intergenic
1199849430 X:151714835-151714857 CACCTGGCCCAGGGGCTCTGGGG + Intergenic