ID: 1029112255

View in Genome Browser
Species Human (GRCh38)
Location 7:98218310-98218332
Sequence CAGAAAGAGGATCAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 574}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029112255_1029112261 1 Left 1029112255 7:98218310-98218332 CCGGCCTCCTGATCCTCTTTCTG 0: 1
1: 0
2: 1
3: 57
4: 574
Right 1029112261 7:98218334-98218356 TGAGGCAGAAACTATGGACAAGG No data
1029112255_1029112263 25 Left 1029112255 7:98218310-98218332 CCGGCCTCCTGATCCTCTTTCTG 0: 1
1: 0
2: 1
3: 57
4: 574
Right 1029112263 7:98218358-98218380 AAGTCCTAGCCAGAGCAATCAGG 0: 500
1: 1485
2: 2479
3: 9378
4: 9649
1029112255_1029112260 -5 Left 1029112255 7:98218310-98218332 CCGGCCTCCTGATCCTCTTTCTG 0: 1
1: 0
2: 1
3: 57
4: 574
Right 1029112260 7:98218328-98218350 TTCTGCTGAGGCAGAAACTATGG No data
1029112255_1029112262 2 Left 1029112255 7:98218310-98218332 CCGGCCTCCTGATCCTCTTTCTG 0: 1
1: 0
2: 1
3: 57
4: 574
Right 1029112262 7:98218335-98218357 GAGGCAGAAACTATGGACAAGGG 0: 1
1: 0
2: 1
3: 27
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029112255 Original CRISPR CAGAAAGAGGATCAGGAGGC CGG (reversed) Intronic
900702286 1:4055787-4055809 CAGGGAGAGAAACAGGAGGCAGG - Intergenic
900709787 1:4106496-4106518 CTGAAAGAGGGCCAGGAGGAGGG + Intergenic
900797632 1:4718775-4718797 CAGAAAGTGCCTTAGGAGGCCGG - Intronic
900851953 1:5150738-5150760 CAGAGAGAGGATGAGGAGAGTGG - Intergenic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901327022 1:8372938-8372960 GAGAAGGGGGATGAGGAGGCAGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901806192 1:11740133-11740155 CTGAAAGAGGAGCTGGAAGCAGG - Intronic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902699066 1:18159206-18159228 ATGAAAGATGATCAGTAGGCTGG + Intronic
902919754 1:19658636-19658658 GAGACAGAGGATCAGGAGCCAGG - Intergenic
903131814 1:21284442-21284464 CAGAAAGAGAATGAGAAGGAGGG + Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191983 1:43904794-43904816 CAGGAAGAGGAACAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192084 1:43905169-43905191 CAGGAAGAGAAACAGGAGGAGGG - Intronic
906192093 1:43905205-43905227 CGGGAAGAGGAACAGGAGGAGGG - Intronic
906192178 1:43905502-43905524 CAGGAAGGGGAACAGGAGGACGG - Intronic
906192237 1:43905718-43905740 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192357 1:43906153-43906175 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192369 1:43906189-43906211 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906201329 1:43962265-43962287 CCGAGAGAGAATCAGGAGTCAGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907416495 1:54318062-54318084 TAGAAAGAGGATGGAGAGGCCGG - Intronic
908752672 1:67439597-67439619 TAGGAAGAGAATGAGGAGGCTGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
912410950 1:109480420-109480442 AAGTAAGGGGATTAGGAGGCAGG - Exonic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913264812 1:117033923-117033945 CAGAAGGAGGAGCAGGACGAAGG - Exonic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915405733 1:155658402-155658424 TAATAAGAGGAACAGGAGGCTGG + Intergenic
915863784 1:159476628-159476650 CAGATAGAGGATCTCCAGGCAGG - Intergenic
915914191 1:159931367-159931389 CAGAAAGAGGATCATGGGTGTGG - Intronic
916023456 1:160814306-160814328 GAGAAAGAGGAAGAGGAGGAGGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916282265 1:163064710-163064732 AAGAAAGAGGAGTAAGAGGCAGG + Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918723340 1:187883350-187883372 CAGATAGAAGGACAGGAGGCTGG - Intergenic
919104402 1:193130881-193130903 TAGAAAGAGAACCAAGAGGCTGG - Intronic
919493770 1:198238261-198238283 CATACATAGGATCAGGAGGTCGG + Intronic
920250070 1:204617566-204617588 CAGAGAGAAGATGGGGAGGCAGG + Exonic
920294866 1:204949868-204949890 CACAAAGAAGGTAAGGAGGCAGG - Intronic
920340400 1:205272036-205272058 CAGGACGAGGACCAGGAGGGTGG - Exonic
920731086 1:208485669-208485691 CATAAAGAGGAACAGGCTGCAGG + Intergenic
920903499 1:210136288-210136310 GAGAGAGAGAAGCAGGAGGCAGG + Intronic
921383125 1:214544961-214544983 CACAAAGAGGTTAAGCAGGCAGG + Intronic
921835266 1:219771979-219772001 CAAAAAGAGGATTGGGAGGCCGG - Intronic
921861220 1:220044426-220044448 CAAAAAATGTATCAGGAGGCTGG + Intronic
922311360 1:224394789-224394811 CATTAAGAGGATAAGCAGGCGGG - Intronic
922726187 1:227924077-227924099 CAGAAAGAGCGTCAGGGGGTTGG - Intronic
923514932 1:234688845-234688867 CAGAAAGTGAATCAGCATGCTGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924617346 1:245623221-245623243 AAGGAAGAGGAGCTGGAGGCAGG - Intronic
1063159508 10:3408955-3408977 AAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1063468927 10:6268723-6268745 CATAAAGAGGTTAAAGAGGCTGG + Intergenic
1064673869 10:17742204-17742226 CAGAAAGAGGGATAGGAAGCTGG + Intergenic
1064828261 10:19430410-19430432 CATAAAGAAAATGAGGAGGCCGG - Intronic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1067211083 10:44260886-44260908 CAGAAAGAGGCTCATGGGGTGGG + Intergenic
1067293496 10:44960949-44960971 CACACAGAGGAACAGAAGGCAGG - Intronic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069374944 10:67784247-67784269 GAGAAAGAAGAAAAGGAGGCAGG + Intergenic
1069589485 10:69632962-69632984 CAGGAAGAGGAGCAGGATGGAGG - Exonic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070741613 10:78907185-78907207 CAGAATGATGCTCAGGAAGCAGG + Intergenic
1070741667 10:78907463-78907485 AAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1070794743 10:79210061-79210083 CACAAAGAGGATTAGGGGGCTGG - Intronic
1071409737 10:85377354-85377376 CAGAGAGAGAATAAGGAGGGAGG + Intergenic
1071747424 10:88437828-88437850 AAGAAAGAAGCTCAGGAGGCCGG + Intronic
1071953864 10:90735500-90735522 CAAGAATAGGATGAGGAGGCAGG + Intergenic
1072503714 10:96043815-96043837 CAGAAAGGGGAACAAAAGGCCGG - Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072787400 10:98293615-98293637 CAGGAAGAGGAACTGGAGGACGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073698725 10:105900596-105900618 AAGAAAGACGATAAGGAGGATGG + Intergenic
1074223368 10:111460181-111460203 TAGAAAGAGGACAAGGAGTCTGG - Intergenic
1074560270 10:114529416-114529438 TAGAAAGAGGATGAAGAGGCCGG - Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074957871 10:118410348-118410370 CAGTGAGAGGCTCAGGAGGGAGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075049898 10:119175731-119175753 GGGAAAGAGGAGCAGGAGGAAGG + Intronic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1077324673 11:1958628-1958650 CGGGAGGAGGATCTGGAGGCCGG - Intronic
1078748696 11:14139760-14139782 CATAAAGAGGATTAGGAGTAGGG + Intronic
1079512961 11:21232480-21232502 AAGAAAGAGGAGGAGGAGGTTGG + Intronic
1080550366 11:33369189-33369211 GAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1081968923 11:47185539-47185561 CAGCCAGGAGATCAGGAGGCTGG + Intronic
1082871401 11:57946225-57946247 GAGAAAGTGGATCAGCAGCCTGG + Intergenic
1083288946 11:61679563-61679585 CACAGAGAGGAGCAGAAGGCGGG - Intergenic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1083444007 11:62695138-62695160 CAGAAAGATGATCTGGAGCGAGG - Intronic
1083474822 11:62909044-62909066 CAGCAACAGGACCAGGAGCCAGG - Exonic
1083540539 11:63508948-63508970 GAGAAAGAGGATGAGGAAGCTGG - Exonic
1083921613 11:65784114-65784136 CAGAAGGAGCATCGGGAGGAGGG + Intergenic
1084071322 11:66737794-66737816 CAGAAAGAGGTTGAGGAAGGAGG + Intergenic
1084380681 11:68810604-68810626 CAAAAAGAGGTTCAGGAATCAGG + Intronic
1085271488 11:75272731-75272753 GAGAAAGAGGAACAGAAGGGAGG + Intronic
1085929271 11:81061659-81061681 CAGGAAAAGGGTCTGGAGGCAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086957494 11:92948704-92948726 CAGAAAGAGGACTAGTAGGGGGG + Intergenic
1087053393 11:93908289-93908311 GAGGGAGAAGATCAGGAGGCTGG + Intergenic
1087095361 11:94312801-94312823 AAGAAAGAAAATCAGAAGGCAGG + Intergenic
1087375632 11:97336278-97336300 CAGAAAGGGGTTCTGGAAGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1089256794 11:117198459-117198481 GAGAAGGAGGCTCAGGAGGCTGG - Intergenic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1090176762 11:124656856-124656878 CAGTGAGAGGCACAGGAGGCCGG + Intronic
1090433477 11:126666296-126666318 CAGAAAGAGGAACGGGTGCCTGG - Intronic
1202807652 11_KI270721v1_random:13805-13827 CGGGAGGAGGATCTGGAGGCCGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1093025208 12:14239514-14239536 CAGAAAGAGGAGCAGGCGTAGGG + Intergenic
1094030811 12:26009705-26009727 AAGAAAGTAGATCAGGAGGAAGG + Intronic
1094669078 12:32551244-32551266 AAGTAAGAGGCTTAGGAGGCTGG + Intronic
1095175504 12:39087326-39087348 CAGAAAGCAAATCAGGAGGTAGG + Intergenic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1095930635 12:47621834-47621856 TAGAAAGAGGCTCATGTGGCCGG + Intergenic
1099181574 12:79476376-79476398 TAGAAACAGTATCACGAGGCGGG - Intergenic
1100339896 12:93668845-93668867 GAGTGAGAGGATCAGGAGTCTGG + Intergenic
1101074105 12:101110248-101110270 CAGAAAGATGGCCAGGAGACTGG - Intronic
1101830617 12:108253668-108253690 CAGGAAGAGGATGAGGAGATGGG - Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102320187 12:111926575-111926597 CAGAAGAAGGATCAAGAGGGAGG - Intergenic
1102478971 12:113207793-113207815 CAGAAAGAGGCTGAGGAGGAAGG - Exonic
1102711039 12:114927224-114927246 CTGATAGACTATCAGGAGGCTGG - Intergenic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103412462 12:120722162-120722184 TAGAAAGAGGATGTGGAGGAAGG + Exonic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1104875329 12:132029779-132029801 CAGAATGAGGATCTTGAGGCAGG + Exonic
1104953659 12:132453632-132453654 CAGGAAGGTGATCAGGAGCCCGG - Intergenic
1105007199 12:132728993-132729015 CAGAAAGAGCATCTAGAAGCTGG + Intronic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1106426256 13:29633208-29633230 TAGAAAGAGGAGCTGGTGGCTGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106682067 13:32018312-32018334 CAGAAACAGGGTCAGGAGAGGGG + Intergenic
1107136564 13:36950926-36950948 CAGATAAAGTATCAGGAGGAAGG + Intronic
1107644451 13:42479440-42479462 CTGGAAGAAGATCAGGGGGCTGG + Intergenic
1108546531 13:51500944-51500966 TAGAAAGAGGAACAGGAGCTGGG + Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1110847131 13:80202749-80202771 CACAGAGAGGATCAGGAAGCTGG - Intergenic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1113389340 13:109880701-109880723 CAGCAAGATGATCAGGAGCGCGG + Intergenic
1113453863 13:110433282-110433304 CAGAAATAGGACCAGGCGGCCGG + Intronic
1115167461 14:30464873-30464895 GAGAAGGAGGGGCAGGAGGCAGG + Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117760509 14:59022373-59022395 CAGAATTAGGATCAGCAGGTCGG + Intergenic
1118140284 14:63072850-63072872 GAGAAGGAGGATGAGGAGGAGGG - Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118882987 14:69844270-69844292 CTGAAAGAGGGTCAGGATACTGG + Intergenic
1120448213 14:84629370-84629392 CAAAAAGAGCATGAAGAGGCTGG + Intergenic
1120576358 14:86186081-86186103 AAGAAAGAAAGTCAGGAGGCAGG - Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121019370 14:90569796-90569818 CTGAGAGAGGCTCAGGGGGCAGG - Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1121832762 14:97066121-97066143 AAGAAAGAGGAGGAGGAGGGAGG - Intergenic
1122099094 14:99393226-99393248 CAGAAAGAGGCACAGCCGGCAGG + Intergenic
1122309049 14:100783211-100783233 GAGAAAGAGGGTCAGGAGAAAGG + Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1124116994 15:26853637-26853659 AAGAAAGAGCATCAGAAGGCTGG - Intronic
1124588839 15:31035831-31035853 CAGACAGAAGACCTGGAGGCAGG + Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1124992741 15:34692025-34692047 AAGAAAGAGAAGCAGGAGACAGG + Intergenic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1126443869 15:48720204-48720226 CAGAGAGAAGATCTGGAGGAAGG + Intronic
1128276277 15:66356498-66356520 CAGGAAGGGGGTCAGGAGGTTGG - Intronic
1129263390 15:74381381-74381403 CAGAAAGGGGCACAGGAGCCAGG + Intergenic
1129599275 15:76988828-76988850 CAGAAACAGGATGAGGAAGAAGG - Intergenic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129797335 15:78388139-78388161 CAGAAAGATATACAGGAGGCTGG + Intergenic
1130539907 15:84814998-84815020 TAGAGAGAGGATGACGAGGCAGG - Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131861797 15:96661610-96661632 CAGAAAGACTACGAGGAGGCAGG + Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133509132 16:6440822-6440844 CAGTAATAGGATCAAGAGGGTGG + Intronic
1133885702 16:9825729-9825751 CAGAGAGAGGATCAGCTGGGAGG + Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135942134 16:26831057-26831079 CAGCAAGAAGTGCAGGAGGCAGG + Intergenic
1135994563 16:27238328-27238350 CTGCCAGAGGATCAGGAGGCTGG - Intronic
1136519120 16:30785080-30785102 CAGAAAGAGGGTCAGGCTGGAGG + Intronic
1137582910 16:49644916-49644938 CAGAGAGTCCATCAGGAGGCTGG + Intronic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1139665254 16:68450599-68450621 TTGAAAGAAGAGCAGGAGGCCGG - Intergenic
1140351972 16:74271111-74271133 CAGAAAGAGGAGCTGGACCCTGG + Intergenic
1140555689 16:75918530-75918552 CAGAAAGAGCATAAGGAAACGGG + Intergenic
1141635873 16:85313525-85313547 CAGGAAGGGGATCAGGGGGGTGG - Intergenic
1142024315 16:87804413-87804435 CAGAGAGAGAATCTGGAGGCTGG - Intergenic
1142096568 16:88243117-88243139 CAGCAAGTGGCTCACGAGGCTGG + Intergenic
1142285469 16:89169860-89169882 CAGCAGGAAGGTCAGGAGGCAGG - Intergenic
1142333594 16:89472074-89472096 CAGAAAGAGCATCAGGATCAGGG + Intronic
1142576665 17:913567-913589 GGAAAAGAGGATAAGGAGGCAGG + Intronic
1142741611 17:1934905-1934927 CAGGCAGAGGCTCGGGAGGCCGG - Exonic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143434895 17:6916072-6916094 CAGAAGGAGATTCAGGAGGGTGG + Intronic
1143805709 17:9424454-9424476 CAGAGAGAGGGCCTGGAGGCAGG - Intronic
1143951843 17:10638745-10638767 CAGAAAGGGAACCATGAGGCAGG + Intronic
1144851409 17:18245921-18245943 CAGCAAGCAGGTCAGGAGGCGGG - Exonic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145802332 17:27696079-27696101 CGGAAAGGGGAACAGGAGACAGG - Intergenic
1146329808 17:31917670-31917692 GAGAAAGGGGGTCAGGAGGGAGG - Intergenic
1146589322 17:34114826-34114848 CAGACATAAGGTCAGGAGGCAGG + Intronic
1146955905 17:36936264-36936286 CAGAAAGAGGGACGGGAGGAGGG + Intergenic
1148063124 17:44850205-44850227 CAGAAAGATGAGCGGGAAGCTGG + Exonic
1148213991 17:45824617-45824639 AAGGAAGAGGATCGGGAGCCCGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149180012 17:53924670-53924692 CTGAAAGAAGAGCAGCAGGCTGG - Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151714218 17:75823280-75823302 AAGAAAGAGGCGGAGGAGGCTGG + Exonic
1153204521 18:2682616-2682638 AAGAAAAAGTATCAGGGGGCCGG - Intronic
1154062995 18:11081097-11081119 CAGAAAGAGGTTCATGACTCAGG - Intronic
1154305356 18:13226865-13226887 AAGAGGGAGGATGAGGAGGCTGG - Intronic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1155148567 18:23104304-23104326 AAGAAGGAGGATCAGGAGGGAGG + Intergenic
1155566212 18:27137548-27137570 GAGAATGAGGCTGAGGAGGCAGG + Intronic
1156268310 18:35508264-35508286 CAGAAGGAGGTACAGGAGGAAGG - Intergenic
1156697105 18:39780348-39780370 GAGAAAGAGGATATGGAAGCAGG - Intergenic
1157453955 18:47809722-47809744 CAAAGAGAGGGTCAGGGGGCGGG - Exonic
1158559196 18:58499434-58499456 CTGAGAGAGGTTCAGGATGCAGG - Intronic
1159446844 18:68551267-68551289 AAGAAAGAGGAAGAGGAGGAAGG + Intergenic
1159869001 18:73739654-73739676 AAGAAAGAGGAACAAGAAGCAGG - Intergenic
1160045795 18:75386219-75386241 TAGAAAGAGGAGCAGGAGAGAGG - Intergenic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160685483 19:434627-434649 CAGAAAGAAGAGCTGGAGGTAGG + Intronic
1161458279 19:4381026-4381048 CAGAGAGAGGGAGAGGAGGCCGG - Intronic
1161534107 19:4808296-4808318 CAGAAATTGGATCACGTGGCCGG - Intergenic
1161960516 19:7520553-7520575 CAGAAACAGCATCAGGACCCAGG - Exonic
1162001590 19:7747605-7747627 CAGAAAGAGAAACAGGAAGTTGG + Intergenic
1162300483 19:9842207-9842229 CCGAGAGAGATTCAGGAGGCAGG + Intronic
1162475085 19:10895043-10895065 CAGATAGAGAATAAGGAGGCCGG - Intronic
1164324425 19:24179474-24179496 GAGGAAGAGGAGCAGGAGGATGG + Intergenic
1164591934 19:29512167-29512189 GAGAAAGAGGATGAAGAGGAAGG + Intergenic
1164596681 19:29534750-29534772 AAGAAAGAGGCTCAGGACACTGG + Intronic
1164795358 19:31022483-31022505 CAGAAAGAGGAAGAAGAGGGAGG - Intergenic
1165344167 19:35233313-35233335 CAGAAAGTGGAAGAAGAGGCAGG + Intergenic
1165470812 19:36003466-36003488 GAGGAAGAGGATAAGGAGGAAGG + Exonic
1165501386 19:36192442-36192464 CATTAAGAGGATCAGCTGGCTGG + Intronic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1166546635 19:43638313-43638335 CAGAAAGAGAAACAGAAGCCTGG + Intronic
1166944942 19:46390710-46390732 CAGAGAGAGGGTCAGCAGGGGGG + Exonic
1167100926 19:47403903-47403925 GAGAAAGAGAGACAGGAGGCTGG + Intronic
1167254370 19:48418512-48418534 CAGACAGGAGCTCAGGAGGCTGG + Intronic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
1168664265 19:58191436-58191458 CAAAAGGAAGATCAGGAGGCTGG - Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
928370612 2:30737492-30737514 CAGGAGGAGGGTCAGGAGTCTGG + Intronic
928745594 2:34410790-34410812 AAGAGAGAGGAGCAGGATGCTGG + Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929258512 2:39839394-39839416 CAGGAAGAGAATAGGGAGGCTGG - Intergenic
929538218 2:42798510-42798532 CATAAAGAGGCTCAAGAGGCCGG - Intergenic
930196923 2:48519446-48519468 CAGAAAGAGGACCAGAATGAAGG - Intergenic
930232906 2:48860652-48860674 CAGAAAGAGGATCAGTTAACAGG - Intergenic
930714084 2:54576348-54576370 CAGAAAGAAGAGCTGAAGGCCGG - Intronic
930787750 2:55286978-55287000 CTGAAAGGGGATGAGTAGGCCGG - Intergenic
931066296 2:58591418-58591440 CAGAAAGAAGAACAAGAGGGTGG + Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931995976 2:67839525-67839547 AAGGAAGAAGATCAGGATGCAGG - Intergenic
932327179 2:70871112-70871134 CACCAGGAGGATCAGGAGCCAGG - Intergenic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
934844784 2:97655791-97655813 CACAAAAAGCCTCAGGAGGCTGG - Intergenic
934858457 2:97743630-97743652 CATAAACAAGAACAGGAGGCCGG - Intergenic
935152734 2:100452533-100452555 CAGAAAGCCGATCAGCAGGCAGG + Intergenic
935277865 2:101491364-101491386 TAGAAATAGGAACAGGGGGCTGG + Intergenic
935403407 2:102683733-102683755 GAGAAAGAGAAACAGGAGGATGG - Intronic
935504672 2:103885405-103885427 AAGGAAGATGAGCAGGAGGCTGG + Intergenic
935634888 2:105242658-105242680 CACGAAGAGGATCAGGATGGTGG - Exonic
935801765 2:106704587-106704609 AGGAAAGAGGATCAGGAGGAAGG - Intergenic
936275481 2:111092945-111092967 CAGCACGAGGATCAGGAATCAGG + Exonic
936697265 2:114965680-114965702 CAGAAAGATAAAGAGGAGGCCGG + Intronic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
937343200 2:121104980-121105002 CAGCAGGAGGAGCAGCAGGCCGG + Intergenic
937468980 2:122159077-122159099 GAGAAAGTGGATCTGGAGCCAGG + Intergenic
938364134 2:130720591-130720613 CACTAGGAGGAGCAGGAGGCAGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
941999571 2:171632463-171632485 CAGAATGAGAATCAGAAGGAAGG + Intergenic
942135218 2:172918844-172918866 CAGGAAGAGGATCTGAAGGGTGG - Intronic
942529161 2:176889716-176889738 CAGGAAGAGCATCAGCTGGCAGG + Intergenic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
943311132 2:186326119-186326141 GAGAAAGAGGAGCAGGAGAAAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943864910 2:192917010-192917032 CAGAAAGAGGATGACCAGACTGG + Intergenic
944204348 2:197141817-197141839 GAGGAAGAGGATGAGGAAGCTGG - Intronic
944318828 2:198312247-198312269 CTGAAAGTGGGTCAGAAGGCTGG + Intronic
944473447 2:200080101-200080123 GGGAAAGAGGATGAGGAGGGAGG + Intergenic
946085100 2:217162915-217162937 CAAGATGAGGATCAGCAGGCAGG - Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946197511 2:218043923-218043945 CAGAAGGGGGCTGAGGAGGCAGG + Intronic
946660476 2:221993786-221993808 CAGAAAGAGGCCCATGTGGCTGG + Intergenic
947231195 2:227888392-227888414 CAGAAGCAGGATCAGGCGGGAGG + Intronic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
947601377 2:231452751-231452773 AAGAAAAAGAATCAGGAGACAGG + Exonic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1169030278 20:2401328-2401350 CAGGAGGAGGATGGGGAGGCTGG - Intronic
1169140453 20:3224609-3224631 CACAAGGAGGCTCAGGAGGCTGG - Intergenic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169859943 20:10140860-10140882 CAGACAGAGGTTCAGGTGACAGG - Intergenic
1170204586 20:13784733-13784755 CCGAAAAAGGCTCAGGAGGAAGG + Intronic
1170531018 20:17291766-17291788 CAGAAATGGAATCTGGAGGCAGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1171059575 20:21943280-21943302 GAGAAAGAGGAGCTGGAGGAAGG - Intergenic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171433934 20:25104651-25104673 CAGCAAGAGGAACCGGGGGCTGG + Intergenic
1171754919 20:29097247-29097269 GAGAAAGAGGAACAGGAGCTGGG - Intergenic
1172014860 20:31867280-31867302 AAGCAAGAGGATCAGGGAGCCGG - Intronic
1172044494 20:32070886-32070908 AAGAAAGAGGAGGAGGAGGGAGG + Intronic
1172442609 20:34976741-34976763 CAGAAAGAGGATGGGGAGGGAGG + Intronic
1172596713 20:36155087-36155109 TGGAGAGAGGATCCGGAGGCTGG + Intronic
1172705363 20:36878665-36878687 GAGACGGAGGATCAGGAGGAGGG + Intronic
1173470560 20:43320367-43320389 CAGACAGAAGGGCAGGAGGCAGG - Intergenic
1175063625 20:56266596-56266618 CAGAACTAGAATCAGGAAGCTGG + Intergenic
1177182517 21:17758461-17758483 GAGACAGAGGAACAGGAGGATGG - Intergenic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178541126 21:33451586-33451608 GTGAGAGAGGATAAGGAGGCGGG + Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179416242 21:41200771-41200793 CAGCAAGAGGAGCAAGAGGACGG + Intronic
1179606402 21:42518367-42518389 CAGAGAGAGGATCTGGAGCCAGG + Exonic
1179799320 21:43803549-43803571 GAGGAAGAGGAGCAGGAGGAGGG + Exonic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181675548 22:24449226-24449248 AAGACAGAGGATTAGGAGGAGGG + Intergenic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183342094 22:37287069-37287091 CAGGAAGAGGATGGGGAGGAGGG + Intronic
1183680956 22:39328901-39328923 CAGAAAAATGATGAGGAGACAGG - Intergenic
1183775461 22:39961288-39961310 GAGAAAGAGGAGCGGGAGACAGG + Intronic
1183980999 22:41540184-41540206 CGGAAGGGGGATCAGCAGGCTGG - Intronic
1184013905 22:41770939-41770961 CAGCAAGATGAGCAGGATGCTGG - Exonic
1184029423 22:41883095-41883117 CAGATAGAGGATGGGGAGTCAGG + Intronic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184699433 22:46160524-46160546 CAGAGGGCGGATCATGAGGCCGG - Intronic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
1185346839 22:50314096-50314118 CTGGAAGAGGATCAGGGGTCTGG + Intronic
949344876 3:3067561-3067583 CAGAATGAGAATCCAGAGGCGGG + Intronic
950114884 3:10444362-10444384 CAGCAGGAGGATGTGGAGGCAGG - Intronic
950454465 3:13084358-13084380 CAGAAAGAGCATCCGGACACAGG - Intergenic
950473394 3:13200410-13200432 CAGAAAGAGAAACATGAGTCTGG - Intergenic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954149795 3:48651669-48651691 CTGACAGGGGTTCAGGAGGCAGG + Exonic
954798207 3:53172213-53172235 CAGCAAGAGGAACAGGAGGTGGG - Intronic
954925569 3:54231298-54231320 CAGAGTGAGGACCAGAAGGCAGG - Intronic
955038524 3:55292509-55292531 CTGGAAGAGGACCAGGGGGCTGG - Intergenic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
956929587 3:74027939-74027961 CAGAGAGAGGATCAGGGGTGAGG + Intergenic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
957683826 3:83474267-83474289 CAATAAGAAGACCAGGAGGCTGG - Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
960153668 3:114276061-114276083 GAGAAAGAGTACCAGGAGGAGGG - Intergenic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960831477 3:121854017-121854039 AAGAAAGAAGATGAGGAGGCTGG + Intronic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962378276 3:134876633-134876655 CAGGGAGAGGCTCAGTAGGCTGG + Intronic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
963003973 3:140708772-140708794 AAGAGAGAGGATGAGGAGGAAGG + Intergenic
965474064 3:169132125-169132147 AAGAGAGAGGATCAGGAGCTGGG - Intronic
965823726 3:172710234-172710256 AAGAAAGAGGACTGGGAGGCTGG - Intronic
966632756 3:182096724-182096746 CAGAAAGAGGTTTTGGAGCCGGG - Intergenic
967156864 3:186700788-186700810 AAGAAAGAGGCTCTTGAGGCCGG - Intergenic
967279241 3:187806253-187806275 GAGACAGAGGGGCAGGAGGCAGG - Intergenic
967867087 3:194198997-194199019 CAGAAAGAGGCTATGGAGGAGGG - Intergenic
968045305 3:195620638-195620660 CACACAGAGGAGCAGCAGGCAGG + Intergenic
968061160 3:195726981-195727003 CACACAGAGGAGCAGCAGGCAGG + Intronic
969543501 4:7808814-7808836 GAGAAAGAGGAGCAGGTGCCAGG - Intronic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971236100 4:24843859-24843881 TAGAAATGGGGTCAGGAGGCAGG - Intronic
972655281 4:41057983-41058005 CATGAAGAGGATTAGGATGCTGG - Intronic
973758898 4:54099916-54099938 GAGAAAGAGGGGGAGGAGGCCGG + Intronic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
977130422 4:93228844-93228866 TAGTGAGAGGATCAGGAGGAAGG + Intronic
977310803 4:95384739-95384761 CAGAAAGCGGGTGAGTAGGCAGG + Intronic
977349116 4:95857737-95857759 AAGAAAGAGGAGCAAGAGACAGG + Intergenic
978134918 4:105245651-105245673 CAGAAAGAGCAAGAGGAGTCAGG - Intronic
979745359 4:124206039-124206061 CAGCCAGAGGGTCAGGAGGTGGG + Intergenic
980546015 4:134262628-134262650 CAGAAAGAACATCAGTGGGCAGG - Intergenic
980616582 4:135234872-135234894 CAGAGAGTGGATCAAGAGCCGGG - Intergenic
981123915 4:141083939-141083961 CAGACATAGGATTGGGAGGCAGG - Intronic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981330463 4:143502557-143502579 CACATAGAGGAACTGGAGGCAGG - Intergenic
981538014 4:145820648-145820670 CAGACAGAGGATGAGTTGGCTGG - Intronic
981601688 4:146496398-146496420 GAGAAAGAGGGACAGGAGACAGG - Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982840968 4:160185588-160185610 AAGACAGATGAGCAGGAGGCTGG - Intergenic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
983729838 4:170979300-170979322 GAGAAAGACCATCAGGTGGCCGG + Intergenic
984552595 4:181179088-181179110 CAGCAAGACGATAAGGAGACTGG + Intergenic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985155419 4:186982812-186982834 CAGAAAGAGGAGCACGATGGAGG - Intergenic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
986163871 5:5256030-5256052 CAAAAAGAAGATCAGGTAGCAGG - Intronic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
989253454 5:39342006-39342028 CAGAAAAATGATTATGAGGCAGG - Intronic
989748950 5:44867898-44867920 TAGAAAGAGGATATAGAGGCCGG + Intergenic
990797049 5:59555311-59555333 CACAAAGAGGATCAGCATACTGG + Intronic
991994135 5:72370589-72370611 CAGAAAGAAGACCAGGGTGCAGG - Intergenic
993007983 5:82448671-82448693 CAGAAAGAAGACCTGGATGCAGG + Intergenic
993109061 5:83632984-83633006 GAGAAAGAGGGACAGGAGACAGG - Intergenic
993363765 5:87009855-87009877 AAGAAAGAGGGTCATGATGCAGG - Intergenic
993505106 5:88699712-88699734 CAGGAAGAGGATGAGGAGAAAGG - Intergenic
993990004 5:94644644-94644666 CTGAAAGATGAGCAGAAGGCAGG - Intronic
995516631 5:112960640-112960662 CAGAAAGAGGATTATGATGTTGG - Intergenic
995542719 5:113200435-113200457 CAGGAAGGGGATCAGCAGGCAGG - Intronic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
997676534 5:135717228-135717250 CAGAAAGAGGACCAGTGGGCAGG - Intergenic
997823677 5:137087806-137087828 CAGAAAGGAGGTCAGGAAGCAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998569626 5:143245599-143245621 GAGAAAGGGGATAAGAAGGCAGG - Intergenic
999247324 5:150162055-150162077 CAGAGAGAGCTTCAAGAGGCTGG + Intergenic
999818088 5:155197925-155197947 CATCAGGAGGGTCAGGAGGCAGG - Intergenic
999912861 5:156224286-156224308 CAGAAAGATAATCATGAGGTAGG - Intronic
1000138006 5:158371740-158371762 GAGAAAGAGGAATGGGAGGCAGG + Intergenic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1000997444 5:167973756-167973778 CAGAGTGAGACTCAGGAGGCAGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001423417 5:171604835-171604857 GAAAAAGAAGAGCAGGAGGCTGG - Intergenic
1001943111 5:175754527-175754549 CAGAAAGGTGACCAGAAGGCTGG - Intergenic
1002359698 5:178660929-178660951 CAGAAATAGCATCTGGAGTCTGG - Intergenic
1002444123 5:179278706-179278728 CAGAGAGAGGATCATGGGGAGGG + Intronic
1002774492 6:317303-317325 CAGCAAGAGGAACACGTGGCAGG - Intronic
1002816545 6:686256-686278 TAAAAAGAGGTCCAGGAGGCCGG - Intronic
1003353267 6:5340849-5340871 CACAAAATGGATGAGGAGGCCGG + Intronic
1003535553 6:6972574-6972596 GAGAAAGAGAGTCAGGAGGCTGG - Intergenic
1004157997 6:13187640-13187662 CAGAAAGAGGAGCAGGTTGAAGG + Intronic
1004217988 6:13720056-13720078 AAGAAAGAGGGTCAGGCGGGTGG - Intergenic
1004276866 6:14244346-14244368 CAGAATGAGGATTAGGACCCAGG + Intergenic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1004660962 6:17708633-17708655 TAGAAACAGGATCAGTGGGCTGG - Intergenic
1005885299 6:30092832-30092854 AGGAATGAGGATCAGGAGTCGGG + Intergenic
1007183406 6:39947196-39947218 AAGAAAGATGAACAGGAGGAGGG + Intergenic
1008491171 6:52088653-52088675 CTGAGAGAGGTTCAGCAGGCAGG - Intergenic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010301890 6:74270805-74270827 AAGCAGGAGGATCAGGAGCCTGG - Intergenic
1011424722 6:87213946-87213968 GAGAAAGAGGATCAAGAGATGGG + Intronic
1011550924 6:88530561-88530583 CAGAAAGAAGGTAAGGAGGGAGG + Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012045479 6:94267110-94267132 CAGAAAGAATATGGGGAGGCAGG - Intergenic
1012345379 6:98179290-98179312 CAGGAAGGGGAACAGGAGACAGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014816973 6:125946668-125946690 AAGAAAGAGTTTCAGGAGGGAGG - Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1014902121 6:126979534-126979556 TAGAAAGAAGGTCAGAAGGCCGG - Intergenic
1015405652 6:132834306-132834328 CAGAAAGAGGATGAGGGAGGAGG + Intergenic
1016234531 6:141847205-141847227 CAGAAACAGAAACAGGAGGAAGG - Intergenic
1016485085 6:144528825-144528847 CATAGAGAGGATTAGGCGGCAGG + Intronic
1016625295 6:146159804-146159826 CAGAACAAGGCTCAGGAGGGAGG + Intronic
1016687502 6:146898277-146898299 CAGATAGGGGTTCATGAGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017180609 6:151548399-151548421 CAGAGAAACGATCATGAGGCTGG + Exonic
1017978270 6:159376331-159376353 TAGAAAGATGAAGAGGAGGCAGG + Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018620497 6:165725633-165725655 AAGAATGAGCATCAGGAGACAGG - Intronic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019610005 7:1931667-1931689 AAGAAAGGGGACCAGGAGGAGGG - Intronic
1020172952 7:5859195-5859217 TAGAAAGAAGCTCAGGAGACAGG - Intergenic
1020334788 7:7054654-7054676 CAGGAAGAGAATCAGGAGAGTGG + Intergenic
1020976381 7:15012349-15012371 CAGAAATAGGAACATGATGCGGG + Intergenic
1021986818 7:26105340-26105362 AAGAAGGAGGATGAGGAAGCTGG - Intergenic
1022015748 7:26346936-26346958 CAGGGAGAGGCTCAGGGGGCGGG - Intronic
1022301440 7:29106147-29106169 CACAGAGAGACTCAGGAGGCTGG + Intronic
1022469943 7:30675945-30675967 GAGCAAGACGATCAGGTGGCTGG + Intronic
1022481005 7:30743032-30743054 AAGAAAGAGGCGCAGGAGGAGGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023836987 7:44074168-44074190 CCCAAGGAGGGTCAGGAGGCGGG - Intronic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024580695 7:50798093-50798115 CTGAAAGAGGATCAGTTGCCTGG - Intergenic
1024822286 7:53346718-53346740 GAGAAGGAGGATGAGGAGGAGGG - Intergenic
1025995324 7:66524056-66524078 CTTAAAAAGGGTCAGGAGGCCGG - Intergenic
1026126528 7:67584424-67584446 TAGTGAGGGGATCAGGAGGCTGG + Intergenic
1026459205 7:70598672-70598694 CAGAAAGAGAATCTGGGGGTAGG - Intronic
1026881139 7:73907632-73907654 CAGAAAGAGGACCTTGAGGGCGG - Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027538894 7:79442973-79442995 CAGAATGCAGATCAGAAGGCTGG + Intronic
1028686479 7:93594712-93594734 CAGAACGTGGATGAGGAGGGAGG + Intronic
1029085838 7:98011060-98011082 TAGAAAGAAGCTCAGGAGACAGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029623564 7:101705641-101705663 GAGAAAGAGGAAGAGGAGGTGGG + Intergenic
1030657237 7:112181742-112181764 AAGAAAGAGTAACAGGAAGCAGG + Intronic
1030892085 7:115011153-115011175 CAGAAACAGGATCAGGACCCAGG - Intronic
1032660506 7:133978760-133978782 CAGAAAGATGCTCAGGCAGCTGG - Intronic
1033223244 7:139542610-139542632 AAGAAAGGGGATCTGAAGGCAGG + Intronic
1033225721 7:139560720-139560742 CAAAAAGAGTGTCAGAAGGCTGG + Intergenic
1033275832 7:139971122-139971144 CAGAAAGAAGGACAGGAGGTGGG - Intronic
1033279403 7:139995158-139995180 CGGTAAGAGGAGCAGGAAGCAGG + Intronic
1033343129 7:140507257-140507279 CAGATGGGGGAACAGGAGGCCGG + Intergenic
1033458818 7:141527063-141527085 CAGAAAGAGGAATTGTAGGCTGG - Intergenic
1033633391 7:143184101-143184123 GAGAGAGAGGATCAGCAGGGTGG - Exonic
1033637155 7:143222716-143222738 GAGAGAGAGGATCAGCAGGGTGG - Exonic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034255794 7:149724003-149724025 CGGGAAGAGGATCCGGATGCGGG + Intronic
1034469249 7:151246858-151246880 CAGGAAGAAGATCAGAGGGCAGG + Intronic
1035024513 7:155817160-155817182 CAGACGGAGCATCCGGAGGCTGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035116141 7:156525855-156525877 CAGAAAAAGAATTATGAGGCTGG + Intergenic
1035223830 7:157422714-157422736 GAGTAACAGGATGAGGAGGCCGG - Intergenic
1035472342 7:159118487-159118509 AAGAGGCAGGATCAGGAGGCAGG - Intronic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036508984 8:9383161-9383183 CAGACAGATGACCAGGAGGAAGG - Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037085131 8:14838918-14838940 CAGAAAGGTGACCAGGAAGCAGG + Intronic
1037131630 8:15413554-15413576 CAGAAAGAGTACCAGGGGACAGG - Intergenic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1037715559 8:21394586-21394608 CTGGAAGAGGGACAGGAGGCAGG - Intergenic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038218728 8:25587305-25587327 CACATAGAGGACCAGGAGGAAGG + Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1040102037 8:43513993-43514015 AAGAAGGAGCATCAGAAGGCAGG + Intergenic
1042124081 8:65519690-65519712 TAGAAAGTTGCTCAGGAGGCTGG + Intergenic
1042487314 8:69361048-69361070 GGGAAAGAGGGTCAGGAGACAGG - Intergenic
1043829408 8:84970000-84970022 CAGAGAGAGGAAGAGAAGGCTGG + Intergenic
1044342330 8:91060776-91060798 GGGAAAGAGCATCAGAAGGCAGG + Intergenic
1044458975 8:92422649-92422671 GAGCATGAGGATCAGGAGACTGG - Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1047424439 8:124732383-124732405 CAGAAGGTGGGTCAGGAGGGAGG + Intergenic
1048106221 8:131413198-131413220 AAGAAAGGGAAGCAGGAGGCAGG + Intergenic
1048545326 8:135381606-135381628 CAGAAAGAGGCACAGGTGGAAGG - Intergenic
1048745796 8:137613771-137613793 CAGAAAGGGGAACAGGAAGCAGG - Intergenic
1048885118 8:138903531-138903553 CAGAAACAGCATCTGGAGGTAGG + Intronic
1049167988 8:141138679-141138701 CAGAAAGGGGATTAGCCGGCCGG - Intronic
1049325491 8:142019443-142019465 CAGCAGGAGGATCAGGAGCACGG - Intergenic
1049660766 8:143818795-143818817 CCGACAGATGGTCAGGAGGCAGG + Intronic
1049826395 8:144671584-144671606 CAGAAAGAGCCTCAGGCGGGAGG - Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1052190437 9:25655332-25655354 CAGAAAGAGGATCAAGTAGGTGG - Intergenic
1052416671 9:28186799-28186821 CAGCAAGAGGACCAGGGTGCCGG + Intronic
1052540493 9:29805025-29805047 TAGTAATAGGAACAGGAGGCAGG - Intergenic
1052707532 9:32011031-32011053 CATAAACAGCATCAGGAGGTAGG + Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1055561851 9:77529155-77529177 CAGAAAGGGGTTCACGAAGCTGG - Exonic
1055584398 9:77742961-77742983 TAGAAAGATCAGCAGGAGGCTGG + Intronic
1055589550 9:77797327-77797349 CAGAAAGATGTACTGGAGGCCGG - Intronic
1056831795 9:89923288-89923310 CAGAAAGAGGCCCTGGAGCCCGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057721424 9:97535037-97535059 AGGGAAGAGGCTCAGGAGGCTGG + Intronic
1058155040 9:101505524-101505546 CAGACAGAGGGTCAGTAGGCTGG - Intronic
1058953642 9:109926101-109926123 TAGGAAGATGATCAGGAGCCAGG + Intronic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059202828 9:112433992-112434014 CAGAGAAAGGATCAGAGGGCCGG + Intronic
1059433178 9:114261840-114261862 CAGAAACAGGCTCAGGATGGTGG - Intronic
1059535610 9:115077484-115077506 TAGAAATATGATGAGGAGGCCGG - Intronic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061836793 9:133334695-133334717 CCGAAAGAGGATCAGGATCGGGG + Intronic
1062106090 9:134755865-134755887 CAGAGAGAAGATCTGGAGGGTGG - Intronic
1062192170 9:135253633-135253655 CAGGAAGAGGAGCATGAGGGCGG - Intergenic
1062244189 9:135555503-135555525 CAGGAAGAGGCTCATGTGGCAGG + Intergenic
1185575471 X:1168957-1168979 GAGAAAGAGGAAGAGGAGGAGGG + Intergenic
1185953897 X:4467777-4467799 CAGAAAGAAGATCAAGATGAAGG - Intergenic
1186996820 X:15132331-15132353 CTGTAAGAGGATGAGAAGGCAGG - Intergenic
1187413716 X:19074030-19074052 CAGAAAAAGAATCAGGAAACTGG + Intronic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189209194 X:39268834-39268856 CAGACAGAAGATCAGAAGGTGGG + Intergenic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190418798 X:50206887-50206909 GAGCAAGAGGCACAGGAGGCTGG - Intronic
1191254250 X:58273001-58273023 CAGGAGTAGGTTCAGGAGGCCGG - Intergenic
1192185817 X:68946215-68946237 GGGAAAGAGGCTCAGGAGGATGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1194467360 X:94250100-94250122 CAGAAAGAGGATGATAAGCCAGG - Intergenic
1195468148 X:105203832-105203854 CAGAAAGAATACCAGGAGCCAGG - Intronic
1196778157 X:119359951-119359973 CAGAAAGGGGAACATGAGGAGGG - Intergenic
1196938873 X:120756138-120756160 GAGAGAGAGGGTCAGGAGCCTGG + Intergenic
1197653496 X:129090442-129090464 TAGAAAGAGGATGAGGGGGGTGG + Intergenic
1198204188 X:134450876-134450898 CAGAAGGAGGATCAGGAAGGTGG + Intergenic
1198789544 X:140328663-140328685 CACAAACAGGATTTGGAGGCAGG - Intergenic
1199417307 X:147599952-147599974 CAGTAAGAGTAGCAGGAGGCTGG + Intergenic
1199426980 X:147713680-147713702 CATACAGAGGATCAGTTGGCTGG + Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1199643640 X:149884877-149884899 CAGGACGATTATCAGGAGGCCGG - Exonic
1200089874 X:153629748-153629770 TAGAAAGAGGGTCTGTAGGCCGG - Intergenic
1200217224 X:154373343-154373365 CAGAAAGAGTGTCAGGAGGTGGG + Intronic
1200735246 Y:6787097-6787119 GGGAAATAGGATCTGGAGGCAGG - Intergenic
1200738470 Y:6827516-6827538 TAGAGGGAGGATCAGGTGGCAGG + Intergenic
1200761791 Y:7045458-7045480 GGGAAATAGGATCTGGAGGCAGG - Intronic