ID: 1029113704

View in Genome Browser
Species Human (GRCh38)
Location 7:98226000-98226022
Sequence CAGCACATAGGGCAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029113698_1029113704 3 Left 1029113698 7:98225974-98225996 CCACAGGACACTCGAGTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 120
Right 1029113704 7:98226000-98226022 CAGCACATAGGGCAGTTCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 183
1029113697_1029113704 6 Left 1029113697 7:98225971-98225993 CCACCACAGGACACTCGAGTGGC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1029113704 7:98226000-98226022 CAGCACATAGGGCAGTTCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029113704 Original CRISPR CAGCACATAGGGCAGTTCTG GGG Intronic
901320272 1:8335716-8335738 CAGCACCAAGGGCAGGCCTGGGG + Intronic
901560339 1:10065309-10065331 CAGGATATAGAGCAGTTATGGGG + Intronic
901875650 1:12165762-12165784 CAGCACATAGGGCATTTCTAAGG - Intergenic
902200120 1:14827049-14827071 GCGCACATCAGGCAGTTCTGTGG + Intronic
903037234 1:20500730-20500752 CTGCAGATAGGGCACTTCTTGGG + Exonic
903791493 1:25896241-25896263 AACCTCATAGGGCTGTTCTGGGG + Intronic
904092424 1:27954674-27954696 CAGCACACAGGGCTGTGGTGAGG - Intronic
907175149 1:52513897-52513919 TAGCGCATAGGGCTGTTATGAGG + Intronic
911126557 1:94346090-94346112 AAACACATAGGGCTGCTCTGTGG - Intergenic
911465003 1:98240376-98240398 CAGAATTCAGGGCAGTTCTGAGG - Intergenic
914908302 1:151764461-151764483 CTGCAGATGGGGCAGTTTTGGGG - Intronic
917662515 1:177191199-177191221 TTGCACATAGAGCATTTCTGAGG + Intronic
917867248 1:179208717-179208739 CAGCTCTTAGAGCAGTTCTGAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919254603 1:195105210-195105232 CAGTACAGAGGGCAGTTGTGGGG - Intergenic
920294456 1:204947318-204947340 CAGCACACATGGGAGGTCTGTGG - Intronic
921308649 1:213821438-213821460 CAGCACAAAGAGCATTACTGTGG - Intergenic
922489023 1:226000309-226000331 CAGCAGAGAAGGCAATTCTGTGG - Intergenic
922756342 1:228099060-228099082 CACCAAATAGACCAGTTCTGAGG - Exonic
1067527513 10:47047401-47047423 AGGCACAAGGGGCAGTTCTGTGG + Intergenic
1068403994 10:56566719-56566741 CAGCCCGTAGAGCAGTCCTGGGG - Intergenic
1070669112 10:78365686-78365708 CAGCACAAAGAGCAGTCCTGGGG - Intergenic
1072956956 10:99895606-99895628 CAGCAGACATGGCAGTGCTGGGG - Intronic
1073807044 10:107109235-107109257 CAGCACAGAGGGGAAATCTGTGG - Intronic
1074357947 10:112802473-112802495 CAGCTCATAGGGTTGTTGTGAGG + Intronic
1074720121 10:116256991-116257013 CAGGACAAAAGGCAGTGCTGGGG + Intronic
1075171180 10:120116370-120116392 CAGCACAAAAGGCACTTCTGAGG + Intergenic
1075911085 10:126126318-126126340 CAGCATCTAGGGCCCTTCTGCGG + Intronic
1077123182 11:920284-920306 GAGCACACGAGGCAGTTCTGAGG - Intergenic
1078096091 11:8298165-8298187 CAGGAGCTAGGGCAGGTCTGGGG + Intergenic
1078099143 11:8319426-8319448 AAGGACATAGGGCAGAGCTGAGG + Intergenic
1079627708 11:22635295-22635317 GAGATCAAAGGGCAGTTCTGTGG + Intronic
1081761622 11:45580592-45580614 CAGCACTCAGGACAGTTCCGAGG - Intergenic
1083269984 11:61567346-61567368 CAGCACCTTGGACAGCTCTGGGG - Intronic
1084393840 11:68896246-68896268 CAGCACATAAAACAGTGCTGAGG - Intronic
1084691623 11:70730564-70730586 CAGCTCATCAGGCAGCTCTGAGG - Intronic
1086649323 11:89268158-89268180 TAGCTCATAGGGTTGTTCTGAGG + Intronic
1091767928 12:3133982-3134004 CAGCGCTTAGGGCTGTTGTGAGG + Intronic
1096982211 12:55734816-55734838 CACCTCACAGGGCAGTTGTGAGG + Intergenic
1098518073 12:71401635-71401657 CAGCACTGAGGGGAGCTCTGAGG - Intronic
1101281717 12:103264247-103264269 CAGGTCATAGAGCAGTACTGTGG + Intronic
1102829432 12:115983202-115983224 CAGCACTGGGGGCATTTCTGCGG - Exonic
1103795571 12:123500744-123500766 CAACTCATAGGGCTGTTGTGAGG + Intronic
1106315030 13:28585747-28585769 CAAGACAAAGGGCAGCTCTGTGG + Intergenic
1109506476 13:63309031-63309053 AAGCACAGAGGGGAGTTCTAGGG + Intergenic
1110235335 13:73211783-73211805 CGGCCCATGGGGCAGTTTTGAGG + Intergenic
1113527350 13:110991649-110991671 CAGGACTTAGGTCAGATCTGTGG + Intergenic
1122832203 14:104403958-104403980 GGGGACACAGGGCAGTTCTGAGG + Intergenic
1122976023 14:105171089-105171111 GGGCCCATAGGGCAGTCCTGGGG + Intergenic
1126719419 15:51561451-51561473 CACCAGACAGGCCAGTTCTGAGG + Intronic
1128212149 15:65910168-65910190 CAGCACAGAGGGAAGTCTTGAGG + Intronic
1129666893 15:77584391-77584413 CAGTGCATAGGGCAGCTCGGAGG + Intergenic
1131260499 15:90885031-90885053 AAGCCCATAGTGCTGTTCTGGGG - Exonic
1134051454 16:11140615-11140637 CAGCACAAAGGGCCACTCTGTGG - Intronic
1134199047 16:12182540-12182562 CAGCACTCAGGGTAGTACTGAGG + Intronic
1134382974 16:13745494-13745516 CAGCACTTAGTGCAGTACTCAGG + Intergenic
1137299571 16:47135244-47135266 TAGCACATGAAGCAGTTCTGTGG + Intronic
1137329787 16:47481615-47481637 CAGCACTTAGGACAGGACTGGGG - Intronic
1137663763 16:50235398-50235420 GTGCACATATGGCATTTCTGTGG + Intergenic
1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG + Intergenic
1139958017 16:70702422-70702444 CACCACAGAGAGCAGTGCTGAGG + Intronic
1141589900 16:85061536-85061558 CAGCACATTTGGGAGTTCTTGGG + Intronic
1142742854 17:1941084-1941106 CAGCACACCGGGTAGTCCTGAGG - Intronic
1142855960 17:2730477-2730499 CAGGTCATGGGTCAGTTCTGGGG + Intergenic
1143139783 17:4735132-4735154 CAGCACATAGGAAAGGGCTGCGG + Exonic
1143261738 17:5604447-5604469 CAGGACACAATGCAGTTCTGAGG + Intronic
1144729200 17:17517045-17517067 CAGCACAGCAGGCAGCTCTGTGG - Intronic
1147970527 17:44217312-44217334 CAGGATACAGGGCAGCTCTGAGG + Intronic
1153194336 18:2577174-2577196 CTTCTCACAGGGCAGTTCTGAGG - Intronic
1155097404 18:22571109-22571131 CAGAACCTAGGGAAGGTCTGGGG - Intergenic
1156570866 18:38251269-38251291 CAGGCCATAGGGCTGTACTGAGG + Intergenic
1157147599 18:45180312-45180334 CATCTCATAGGGCTGTTGTGAGG + Intergenic
1161058765 19:2203765-2203787 CAGGACATAGGGCAGGTTTGGGG + Intronic
1161626548 19:5330343-5330365 CACCTCTCAGGGCAGTTCTGAGG + Intronic
927246122 2:20958356-20958378 CAGCCCACAGGGCAGAGCTGCGG + Intergenic
927794687 2:26037671-26037693 TACCACATAGGGTAGTTGTGAGG + Intronic
931443701 2:62309199-62309221 CACCTCAGAGGGCAGTTGTGAGG - Intergenic
933232976 2:79830333-79830355 CAGGTCAAAGGGAAGTTCTGGGG + Intronic
939204327 2:139080628-139080650 CTGCACTTAGGGGAATTCTGTGG + Intergenic
941071899 2:160964864-160964886 CATCACATAGGGCTATTGTGAGG - Intergenic
941449287 2:165640242-165640264 CATCACATAGTGCTGTTATGAGG - Intronic
942196530 2:173526125-173526147 AAACAGATAAGGCAGTTCTGGGG - Intergenic
942206028 2:173620650-173620672 CATGACAAAGGGAAGTTCTGTGG + Intergenic
942740501 2:179171096-179171118 GAGCATATAGGGGAATTCTGGGG + Intronic
947624589 2:231611761-231611783 CAGCAGAGAGGGGAGGTCTGAGG + Intergenic
948177132 2:235952887-235952909 CAGCCCATAGGGCAGCTTTGAGG - Intronic
1169268961 20:4184725-4184747 CAGCAGAAAGGGCCTTTCTGAGG - Intronic
1170509237 20:17059786-17059808 TAGCTCATAGGGCAGTCCTGAGG - Intergenic
1171343528 20:24448403-24448425 CAGCTCATAGGGCGGGTGTGGGG + Intergenic
1172445030 20:34988608-34988630 CTGCACCCAGGGCAGTTCTAGGG - Intronic
1172943505 20:38670911-38670933 CATTTCATAGGGCAGTTCTCAGG - Intergenic
1173167273 20:40694249-40694271 CATCTCATAGGGCAGTTGTGAGG - Intergenic
1175034681 20:55988787-55988809 CAGCCCATGGGGCCGTTGTGGGG - Intergenic
1178040302 21:28633417-28633439 AAGCACACAGGGCAATTCTCTGG + Intergenic
1178066986 21:28915280-28915302 CACCTCATAGGGTAGTTCTGGGG + Intergenic
1178199611 21:30389239-30389261 CAGCCCAGAGGGTAGTTCTAGGG - Intronic
1178905959 21:36636529-36636551 CAACTCATAGGGTAGTTGTGAGG + Intergenic
1179080747 21:38168682-38168704 CAGCACAAAGGGGATGTCTGTGG - Intronic
1179584316 21:42365251-42365273 CAGCACAGGGGGCAGAGCTGGGG + Intronic
1180064766 21:45406632-45406654 CGGCTCAGAGGGCAGCTCTGCGG - Intronic
1180197551 21:46206787-46206809 CAGCACATGGGCGAGTTCTAGGG - Intronic
1181032755 22:20156268-20156290 CTCCACATAGGGCAGCTCTGAGG - Intergenic
1181510672 22:23387336-23387358 CTCCCCATAGGGCAGCTCTGAGG + Intergenic
1181726503 22:24814780-24814802 CAGCCCCCAGGGCAGTGCTGTGG + Intronic
1181851244 22:25751458-25751480 CACGACATAGGGCACGTCTGAGG + Intronic
1182143228 22:27980608-27980630 CAGCACATGGAGCAGACCTGAGG - Exonic
1182728631 22:32469409-32469431 CGCCACATAGGGCAGTCTTGGGG + Intergenic
1182821378 22:33219582-33219604 GAGCCAATAGGGCATTTCTGTGG + Intronic
949514722 3:4796643-4796665 CAGCATTCAGGCCAGTTCTGGGG + Intronic
950936917 3:16848388-16848410 CATCTCATTGGGCAGTTCTGGGG - Intronic
951946575 3:28143744-28143766 GAGCACATGAGGCAGATCTGTGG + Intergenic
953344647 3:42165277-42165299 CTGCACAAAGGGCAGTTTTGAGG + Intronic
954368579 3:50158593-50158615 GAGTACACAGGGCAGATCTGGGG + Intronic
954995011 3:54873139-54873161 CACCTCATAGAGCTGTTCTGAGG + Intronic
956199658 3:66693123-66693145 TAGCACAAAGGAAAGTTCTGAGG + Intergenic
960037746 3:113118683-113118705 CAGCTGATAGGGCAGTCCTCTGG + Intergenic
967815547 3:193795518-193795540 AAGCAGAGAGGGCAGTGCTGTGG - Intergenic
968503968 4:963544-963566 CAGCTCAGTGGGCAGGTCTGAGG - Intronic
969477180 4:7428288-7428310 CAGCACAAAGGGCAGACCAGAGG + Intronic
969490995 4:7499250-7499272 CACCACATGGGGCAGGTCGGGGG + Intronic
970287114 4:14530293-14530315 TACCACATAGAGCTGTTCTGAGG - Intergenic
978723662 4:111945207-111945229 CAGCACCCAGGACAGTGCTGTGG + Intergenic
982694766 4:158587048-158587070 CAGAACACAGGGCTGTTTTGTGG - Intronic
984483119 4:180331172-180331194 GAGCACATATGTCAGTTGTGTGG - Intergenic
984896660 4:184547492-184547514 CAGAACACAGAGCATTTCTGAGG + Intergenic
985710078 5:1423042-1423064 CAGCACCTTGGGCAGTACTGTGG - Intronic
986278492 5:6302885-6302907 CAGCACCAAGGTCAGTTCTGGGG - Intergenic
986345833 5:6834201-6834223 CTGTTCATAGGGCAGTTGTGAGG + Intergenic
986886919 5:12250167-12250189 CAGAAAAGAGGGAAGTTCTGTGG - Intergenic
989077461 5:37579149-37579171 CAGCACTTAGAGCAGTTCTTGGG + Intronic
989216397 5:38908419-38908441 CAGCAGCTAGGGCAGTGCAGTGG - Intronic
990122465 5:52471802-52471824 CAGCTCATAGGGCTGTGATGAGG + Intergenic
990383092 5:55234232-55234254 CAGCACAAACGGCCCTTCTGAGG - Intergenic
991249298 5:64542277-64542299 CAGGACAAGGGGAAGTTCTGGGG - Intronic
991294554 5:65066628-65066650 CAACACTGAGGGAAGTTCTGTGG + Intergenic
991492840 5:67200055-67200077 CAGGAAATTGGGTAGTTCTGTGG - Intergenic
992979792 5:82157035-82157057 CAGCACATCTGGCAGTTTTCTGG - Intronic
993856499 5:93082741-93082763 AAGCACCTAGGGAAGTTCTTAGG + Intergenic
994107928 5:95966920-95966942 CTGGACATAGTTCAGTTCTGTGG - Intergenic
994569516 5:101497447-101497469 GAGTTCATAGGGCTGTTCTGAGG - Intergenic
995991157 5:118241203-118241225 CGGCACATATTGCAGTTCTCAGG + Intergenic
997767547 5:136520005-136520027 CAGCACAGAAGGCTGTCCTGAGG + Intergenic
998892574 5:146762380-146762402 CTGCACAGAAGGCAGTTATGAGG + Intronic
1001419695 5:171577301-171577323 CGGCCCATTGGGCAGCTCTGTGG - Intergenic
1004183176 6:13398194-13398216 TACCTCATAGGGCTGTTCTGAGG + Intronic
1004266565 6:14153215-14153237 CAGCAAATGAGGCAGGTCTGGGG - Intergenic
1006908430 6:37548383-37548405 CACCACAGAGGGCTGTTGTGAGG - Intergenic
1007700073 6:43761294-43761316 CTGCAAAAAGGGCATTTCTGTGG - Intergenic
1009790904 6:68400219-68400241 CAGCCCATTAGGCAGTTGTGGGG - Intergenic
1010736379 6:79448489-79448511 TACCACATAGGGTTGTTCTGAGG + Intergenic
1011238337 6:85242592-85242614 CAGAAGTTATGGCAGTTCTGGGG - Intergenic
1013608904 6:111775790-111775812 GAGCTCTTAGGCCAGTTCTGAGG + Intronic
1015353770 6:132253080-132253102 GAGGACAGAGGGCAGATCTGGGG + Intergenic
1015720314 6:136234821-136234843 CAGCACATAGCTCAATTCTGTGG - Intronic
1016616549 6:146055279-146055301 TGGCACATAAGGAAGTTCTGTGG + Intronic
1020012953 7:4816367-4816389 CAGCTCCTCGGGCAGTTCGGGGG + Exonic
1020279612 7:6643587-6643609 CAGCTCGTAGGGCAGAGCTGTGG - Intronic
1021972468 7:25979400-25979422 CATCACATAGGCTAGTTGTGGGG + Intergenic
1022101941 7:27174082-27174104 CAGCCCGTAGGGCAGGTCGGCGG + Exonic
1023833898 7:44057447-44057469 CTAGACATTGGGCAGTTCTGAGG - Intronic
1024097777 7:45998251-45998273 CAGCACATTCAGCAGTCCTGTGG - Intergenic
1024677315 7:51648383-51648405 CAGCACAGAGGGAAGTTGTTTGG + Intergenic
1024797578 7:53036702-53036724 GAGCACAGAGGGAAGATCTGGGG - Exonic
1025231503 7:57205847-57205869 CATCTCATAGGGCTGTTGTGAGG - Intergenic
1027529801 7:79316044-79316066 CAGCACACAGGGTAATTGTGAGG + Intronic
1029113704 7:98226000-98226022 CAGCACATAGGGCAGTTCTGGGG + Intronic
1031571002 7:123359227-123359249 CAGCTCAGAGGGTAGTGCTGTGG - Intergenic
1032081496 7:128860690-128860712 CACCTCATAGGGCTGTTATGAGG - Intergenic
1032613415 7:133440867-133440889 CAGCCCTTGGGGCAGCTCTGTGG + Intronic
1034264833 7:149775901-149775923 CAGCCCAGTGGCCAGTTCTGGGG - Intergenic
1034474594 7:151275227-151275249 CAGCACCAAGGGCCATTCTGAGG + Intronic
1034719906 7:153282038-153282060 CCAGACATAGTGCAGTTCTGAGG - Intergenic
1034977383 7:155456363-155456385 CATCCGATAGGGCAGCTCTGGGG - Intergenic
1035831615 8:2700999-2701021 CAGCACATCCGGCAGTTTTCTGG + Intergenic
1035891977 8:3355588-3355610 CCCCACATCGTGCAGTTCTGTGG - Intronic
1040240844 8:45448013-45448035 CCTCACATAGAGCAGTTGTGCGG + Intergenic
1042305900 8:67332901-67332923 AAGCATATAGGGTTGTTCTGAGG + Intronic
1042744388 8:72091344-72091366 AAGAGCATAGAGCAGTTCTGGGG + Intronic
1042835838 8:73078545-73078567 CAGCACATCGGGCTCTTCAGTGG - Intronic
1043615015 8:82114656-82114678 CAGCCCATATGGCAGTTCTGAGG + Intergenic
1047430467 8:124786729-124786751 CATCTCATAGGGCTGTTGTGAGG + Intergenic
1048179934 8:132185278-132185300 CTGCACACAGGGCAGTGGTGTGG - Intronic
1049479117 8:142811611-142811633 CAGCACAGAAGGCTGCTCTGGGG + Intergenic
1049865739 8:144934344-144934366 TGGCACGTAGGGCAGCTCTGTGG - Intronic
1050056689 9:1662665-1662687 CAGGAGATAGGCCAGTTCTCAGG + Intergenic
1051668522 9:19487753-19487775 CTGCACTTAGGGCTGTTCAGCGG + Intergenic
1055203525 9:73697273-73697295 CTGAACATTGGCCAGTTCTGTGG + Intergenic
1055618804 9:78101590-78101612 CACAACATAAGGCAGCTCTGGGG + Intergenic
1057160308 9:92884325-92884347 CTCCACACAGGGCAGTTGTGAGG + Intergenic
1057194127 9:93107332-93107354 CAGGAAATAGCTCAGTTCTGGGG - Intronic
1058928917 9:109699058-109699080 CAGCACATAGGACATTTTTATGG + Intronic
1059287424 9:113186873-113186895 CACTTCATAGGGCTGTTCTGTGG + Intronic
1060500516 9:124150180-124150202 CAGCACCAAGGAGAGTTCTGAGG + Intergenic
1060662371 9:125411787-125411809 CAACTCCTAGGGCAGTTGTGGGG + Intergenic
1061121234 9:128643807-128643829 GAGAACACAGGGCAGTTCTGTGG + Intronic
1186285943 X:8044286-8044308 CAGCACACAGGGGAGGCCTGAGG + Intergenic
1187598247 X:20798745-20798767 AGGTACATAGCGCAGTTCTGAGG - Intergenic
1193598070 X:83473182-83473204 CAGCAGACATGGCAGTGCTGTGG - Intergenic
1197728558 X:129792390-129792412 CAGTACACAGGGCCTTTCTGTGG + Exonic
1198790426 X:140339640-140339662 CAGGAGCTAGGGAAGTTCTGTGG + Intergenic
1199977338 X:152902124-152902146 CAGCCCCAAGGGCAGCTCTGCGG - Intergenic
1201241409 Y:11960510-11960532 CTGTACAAAGTGCAGTTCTGTGG - Intergenic
1201553750 Y:15246687-15246709 CTGCACATATTGGAGTTCTGGGG + Intergenic