ID: 1029114114

View in Genome Browser
Species Human (GRCh38)
Location 7:98228690-98228712
Sequence CAGTAGGAACAGAGGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 369}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029114104_1029114114 20 Left 1029114104 7:98228647-98228669 CCTGGAACGCCCCGTTTCAGTGT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 369
1029114109_1029114114 -9 Left 1029114109 7:98228676-98228698 CCGCCTTCGTTTTCCAGTAGGAA 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 369
1029114105_1029114114 11 Left 1029114105 7:98228656-98228678 CCCCGTTTCAGTGTCTGTTTCCG 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 369
1029114106_1029114114 10 Left 1029114106 7:98228657-98228679 CCCGTTTCAGTGTCTGTTTCCGC 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 369
1029114107_1029114114 9 Left 1029114107 7:98228658-98228680 CCGTTTCAGTGTCTGTTTCCGCC 0: 1
1: 0
2: 2
3: 18
4: 239
Right 1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029114114 Original CRISPR CAGTAGGAACAGAGGGACCC TGG Intronic
900269678 1:1780748-1780770 CAGCAGGAACAGAAGGGTCCAGG + Intergenic
902541098 1:17155382-17155404 CAGGAGGACCAGAGAGACCTTGG + Intergenic
903016183 1:20363622-20363644 CAGTAGGAGCAGCTGGAACCTGG - Intergenic
903860436 1:26361275-26361297 CAATAGGAACGGTGAGACCCAGG + Intergenic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
907980330 1:59474063-59474085 CAGTTGGAACAGAGTGATGCAGG - Intronic
910463352 1:87471153-87471175 AAGTGGTAACACAGGGACCCAGG - Intergenic
911106834 1:94140042-94140064 CAGTGGGAACACATGGACACAGG + Intergenic
911864918 1:103006279-103006301 CCGTTGGACCAGGGGGACCCTGG + Exonic
912548611 1:110469074-110469096 CAGTGGGCACTCAGGGACCCAGG + Intergenic
912553246 1:110497916-110497938 CAACAGGAGCAGAGGGACACTGG + Intergenic
915044696 1:153002337-153002359 CAGTGTGAACAGAGGCTCCCAGG + Intronic
915494015 1:156268222-156268244 CAGTAGGACCATAGGGACTGCGG - Intronic
915507754 1:156368242-156368264 CAGTGGGCACACAGGGAACCTGG + Intergenic
915807188 1:158866361-158866383 CAGTAAGAACACATGGACACAGG + Intergenic
915859513 1:159429376-159429398 CAGTTAGGACAGAGAGACCCTGG + Intergenic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
916705478 1:167345009-167345031 CAGTGGGAACACATGGACACAGG + Intronic
916843206 1:168621644-168621666 CAGAAGGAACTTAGGGACCCTGG + Intergenic
917186733 1:172364828-172364850 CAGTAGCAAGAGAGGGAGCAGGG - Intronic
917361270 1:174178779-174178801 CAGTAAGAACACATGGACCCAGG + Intronic
917393273 1:174562801-174562823 CAGTGAGAACACAGGGACACAGG + Intronic
917540331 1:175906456-175906478 CGGTAGGTACAGAGCGACTCTGG + Intergenic
918758823 1:188374245-188374267 CAATAAGAACATAGGGACACAGG + Intergenic
919130826 1:193448448-193448470 CAGAAAGTACAGAGGGCCCCTGG - Intergenic
920200395 1:204256697-204256719 CACTAGGCACAGAGCGTCCCTGG + Intronic
920367404 1:205455420-205455442 CCCTTGGAACAGAGGGCCCCAGG - Intronic
920562574 1:206949231-206949253 CAGTAGGATCAGTGGGCTCCAGG - Intergenic
921096955 1:211895021-211895043 CACTAAGAACAGAGGGACTGGGG - Intergenic
923131426 1:231078123-231078145 GAGTGGGGAAAGAGGGACCCAGG - Intergenic
923654506 1:235904133-235904155 CAATAAGAACACAGGGACACAGG + Intergenic
924401216 1:243684351-243684373 CAGTGAGAACACAGGGACACAGG - Intronic
924616184 1:245613763-245613785 GAGTAGGAAGAGAGGCACCGAGG - Intronic
1063599292 10:7465453-7465475 CAGTAAGAACACATGGACACAGG + Intergenic
1064253600 10:13725688-13725710 CTGTGGGAACCGAGGAACCCTGG + Intronic
1064256037 10:13743459-13743481 CACTAGGGAGAGAGGGTCCCTGG + Intronic
1067298136 10:44986978-44987000 AAGTAGGAACAAAGGCCCCCTGG - Intronic
1067344776 10:45429200-45429222 CAGGAGGAAGAGGGAGACCCTGG + Intronic
1067975859 10:51024750-51024772 CAGGAGGAAGAGAGGGAAACGGG + Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068121626 10:52786705-52786727 GAGTAAGAAGAGATGGACCCTGG + Intergenic
1070818325 10:79339391-79339413 AAGAAGGCACAGAGTGACCCAGG - Intergenic
1071370712 10:84948759-84948781 CAGCGAGAACACAGGGACCCAGG - Intergenic
1072446768 10:95505425-95505447 CAGAAGGAATACAGGGATCCTGG + Intronic
1073557181 10:104464710-104464732 CAGTGGGTCCAGTGGGACCCCGG + Intergenic
1074399480 10:113129932-113129954 CTGCTGGAACAGAGAGACCCCGG - Intronic
1074894214 10:117760960-117760982 CAGAAGGGACAGGGAGACCCTGG + Intergenic
1075105640 10:119538452-119538474 CTGTTGGAGCAGGGGGACCCAGG + Intronic
1076272122 10:129162933-129162955 CAGCAGGAACAGAAGGCCTCCGG + Intergenic
1076319385 10:129566768-129566790 CCGTGGAATCAGAGGGACCCTGG - Intronic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1078276124 11:9849111-9849133 CAGTAGAAATAGGGAGACCCAGG - Intronic
1078418101 11:11182421-11182443 CAGTGGGAAGAGAGCGAGCCGGG + Intergenic
1079121138 11:17686037-17686059 CAGTAGGAGGAGAGAGACCGGGG + Intergenic
1079133030 11:17760600-17760622 CAGCAGGTACAGAGGGCCCTAGG - Intronic
1079563164 11:21848121-21848143 CAGTGGGAACACATGGACACAGG - Intergenic
1079816925 11:25072921-25072943 CAGGAGGACCAGAGAGACCTTGG + Intronic
1082878189 11:58010039-58010061 CAATAAGAACACAGGGACACAGG - Intergenic
1083147701 11:60771350-60771372 GAGTGTGAACAGGGGGACCCAGG + Intronic
1084032596 11:66489688-66489710 CAGTAGGAACAGCCGGTCGCTGG + Intronic
1084169488 11:67393819-67393841 AAGAAGGAAGAGAGAGACCCGGG - Intronic
1084408832 11:68994373-68994395 CAGCAGGAACAGCGGGGACCCGG + Intergenic
1084422449 11:69067115-69067137 CAGGAGGAGCAGAGGGGCCCAGG - Intronic
1084578213 11:70004522-70004544 CAGTGGGAACACAGGGTTCCAGG + Intergenic
1085152069 11:74260240-74260262 CATAAGAGACAGAGGGACCCAGG + Intronic
1087871304 11:103295934-103295956 CAGGAGGACCAGAGAGACCTCGG - Intronic
1088378079 11:109163316-109163338 CAGTAAGAACATATGGACACAGG - Intergenic
1089679326 11:120110578-120110600 CAGTGAGAACAGAGGGGCCCGGG + Intergenic
1089913203 11:122124494-122124516 CAGTAAGAACACATGGACACAGG - Intergenic
1091014596 11:132038824-132038846 CAGGAGGGACGGAGGGACACAGG - Intronic
1091284679 11:134402034-134402056 AAGCAGGAACAGAGGGAGCCAGG - Intronic
1091312348 11:134583664-134583686 CAGAGGGAACAGAGGTGCCCAGG + Intergenic
1091739283 12:2948701-2948723 CAGGAGGATCACTGGGACCCAGG - Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095981884 12:47978722-47978744 CAGAAGGACCAGGGGGACCAGGG + Exonic
1096328452 12:50687681-50687703 CAATAGGAACACATGGACACAGG + Intronic
1096366618 12:51033597-51033619 CAGGAGGAACACATGGGCCCAGG + Intergenic
1096603153 12:52744863-52744885 CTGGAGCAACAGAGGTACCCAGG - Intergenic
1097772419 12:63603565-63603587 CAGTGAGAACACATGGACCCAGG - Intronic
1097816024 12:64074523-64074545 AAGTGGGAAAAGAGAGACCCTGG - Intronic
1098529126 12:71520664-71520686 CAGTGAGAACAGATGGACACAGG + Intronic
1099205565 12:79722197-79722219 CCGTAGCCACAGAGGGTCCCAGG - Intergenic
1099718045 12:86322170-86322192 CAATAAGAACAGATGGACACAGG + Intronic
1100177453 12:92047262-92047284 CAGTAGGAACAGAAGGTTGCTGG - Intronic
1100199098 12:92279337-92279359 CAGGAGGATCAGAGGGAATCAGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1101946726 12:109143000-109143022 CAGGAGGGACAGAGGGATCTTGG + Intronic
1102481874 12:113229455-113229477 CAGCAGGGACAGGGGGACGCTGG - Intronic
1103191223 12:119003657-119003679 CAGAAAGATCAGAGGGACACTGG + Intronic
1103852463 12:123942121-123942143 CAGCAGGCACAGAGGGCCCTGGG + Intronic
1105202892 13:18194730-18194752 CAGGAGGCAGGGAGGGACCCTGG - Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106498002 13:30299081-30299103 CAAGAGGAACAGTGGGAGCCTGG + Intronic
1107821127 13:44286608-44286630 CAGGAGAAAGAGAGGGGCCCAGG - Intergenic
1108917721 13:55636374-55636396 CAGTGAGAACAGATGGACACAGG + Intergenic
1110117077 13:71831908-71831930 TGGTGGGAACAGAGCGACCCTGG + Intronic
1110337819 13:74352503-74352525 CAGTGAGAACAGATGGACACAGG + Intergenic
1111573101 13:90113859-90113881 CAATGAGAACACAGGGACCCAGG + Intergenic
1112001184 13:95211399-95211421 CAGTTCGAACTGAGGGACACTGG + Intronic
1112829593 13:103432555-103432577 CACTGGGCACAAAGGGACCCAGG - Intergenic
1113049452 13:106193314-106193336 CAGTAAGAACACAGGGACACAGG + Intergenic
1113522871 13:110953103-110953125 GAGATGGGACAGAGGGACCCAGG - Intergenic
1113662490 13:112117089-112117111 CAGTGGGAAGAAAGGGACACGGG + Intergenic
1113702505 13:112397718-112397740 GAGATGGGACAGAGGGACCCAGG + Intronic
1114757471 14:25276030-25276052 CAGTAGCAACACAGGATCCCAGG - Intergenic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1116915217 14:50518437-50518459 CAGTGAGAACACAGGGACACAGG - Intronic
1117988638 14:61412885-61412907 CTGTAGGAAGAGAGGTTCCCTGG - Intronic
1118462540 14:66000059-66000081 CAGGAGGACCAGAGAGACCTTGG - Intronic
1118479759 14:66152633-66152655 CAGAAGGAACTGAATGACCCTGG - Intergenic
1119059855 14:71463351-71463373 CAGTGGGTACAGTGGGTCCCCGG - Intronic
1121817200 14:96937941-96937963 CAGGAGCTACAGAGGAACCCAGG - Intergenic
1122129325 14:99596013-99596035 CAGTAATGACAGAGGGCCCCAGG + Intronic
1123576085 15:21670677-21670699 CAGTGAGAACACAGGGACACAGG - Intergenic
1123612706 15:22113151-22113173 CAGTGAGAACACAGGGACACAGG - Intergenic
1123779725 15:23614347-23614369 CAGTAAGAACACATGGACACAGG - Intronic
1123796561 15:23777909-23777931 CAGTAGGAACTGAGGTAACTAGG + Intergenic
1124798361 15:32804704-32804726 CAGTGAGAACAGATGGACACAGG - Intronic
1125578217 15:40769115-40769137 CGGGAGGAACAGGGGAACCCAGG - Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1125930430 15:43595795-43595817 CGGTGGGAACTGAGGGCCCCTGG - Intronic
1125943598 15:43695627-43695649 CGGTGGGAACTGAGGGCCCCTGG - Intronic
1126466431 15:48965078-48965100 CAGAAGCAACACAGGGACCCAGG - Intergenic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128240113 15:66095994-66096016 CAGTGAGAACAGGGGGAGCCCGG - Intronic
1129809947 15:78502150-78502172 CAGGAGGAACAGAGAGACAGGGG + Intergenic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1130036285 15:80364628-80364650 AAGTAGCAACATAGGGGCCCAGG + Intronic
1131534029 15:93219299-93219321 CAGGAGGAACAGAAGGGCCCAGG - Intergenic
1131830813 15:96353677-96353699 CAGTGCGAAGAGAGAGACCCAGG + Intergenic
1131838154 15:96410315-96410337 CAGCTGGGTCAGAGGGACCCTGG - Intergenic
1132165732 15:99587251-99587273 CAGTAAGAACACATGGACACAGG - Intronic
1202984953 15_KI270727v1_random:404922-404944 CAGTGAGAACACAGGGACACAGG - Intergenic
1132803355 16:1764708-1764730 CAGCAGGCACAGAGGAGCCCAGG + Intronic
1133234336 16:4380885-4380907 CGGCAGCAGCAGAGGGACCCTGG - Exonic
1135021360 16:18965811-18965833 CAGAAAGAACAGAAAGACCCGGG + Intergenic
1136078860 16:27838563-27838585 CAGCAGGGGCAGAGGGACACAGG + Intronic
1136089229 16:27906555-27906577 CAGGAGGTGCAGAGGGCCCCGGG - Intronic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1137551417 16:49440156-49440178 CTGTAGGGAGAGAGGGACTCAGG - Intergenic
1138146305 16:54615378-54615400 AAGGAAGAACAGAGGGTCCCTGG - Intergenic
1139053431 16:63153077-63153099 CAATGGGAACAGATGGACACAGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139909834 16:70390966-70390988 CACTAGGAACACAGGGAGCCAGG + Intronic
1140924052 16:79566014-79566036 CAGGAGGATCAGAGTGGCCCAGG - Intergenic
1140977068 16:80070183-80070205 CAGAGGGGACAGAGAGACCCAGG - Intergenic
1141992749 16:87619958-87619980 CAGAAGGAACAGGGCCACCCTGG + Intronic
1142866898 17:2796647-2796669 CCGTGGGAACAGAGGGGCTCGGG + Intronic
1142918005 17:3159317-3159339 CAGTGAGAACACAGGGACACAGG + Intergenic
1143520759 17:7443018-7443040 AGTTAGGCACAGAGGGACCCAGG - Intronic
1144077807 17:11734606-11734628 CAGAAGGAAGTGGGGGACCCAGG + Intronic
1144655194 17:17030782-17030804 CCTTAGGAGCAGAGGGGCCCTGG - Intergenic
1145797533 17:27664477-27664499 GACCAGGCACAGAGGGACCCTGG - Intergenic
1147536604 17:41326157-41326179 CAGGAGGAACAGAGGTGCTCAGG - Intergenic
1147587241 17:41659518-41659540 CAGGGGGAAGAGAGGCACCCTGG + Intergenic
1147626401 17:41903378-41903400 CAGTAGGATGAGAGGAGCCCCGG + Intronic
1148763971 17:50026889-50026911 GAGGAGGAACAGGGTGACCCCGG + Intergenic
1148793827 17:50187875-50187897 CAGGAGGGCCAGGGGGACCCTGG + Exonic
1151450303 17:74194684-74194706 AAGAAGGAACACAGTGACCCAGG + Intergenic
1151577060 17:74958226-74958248 CAGGAGGGACAGAGGCACCGTGG + Intronic
1152443471 17:80325328-80325350 CAGTTTGGACAGAGAGACCCTGG + Intronic
1153488274 18:5624093-5624115 CAGGAGGAACAGTTGAACCCAGG - Intronic
1156245761 18:35296330-35296352 TATCAGGAACAGAGGGAGCCTGG + Intergenic
1156264862 18:35478577-35478599 CTGTGGGAATAGAGGGTCCCTGG - Intronic
1156822964 18:41394740-41394762 CAGTAGGAACATCAGGGCCCTGG - Intergenic
1157068670 18:44380969-44380991 CAGTAAGAACACATGGACACAGG + Intergenic
1158453294 18:57586091-57586113 AAGTGGGCACAGAGGGACCAAGG + Intronic
1158782957 18:60674136-60674158 CAGTTGGAACACATGGACACAGG + Intergenic
1159705207 18:71677637-71677659 CAATAGGAACACATGGACACAGG - Intergenic
1159840852 18:73396929-73396951 CAGTAAGAACACATGGACACAGG - Intergenic
1160046565 18:75392152-75392174 GAGCAGGAACAGGAGGACCCAGG - Intergenic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1163074438 19:14876704-14876726 CAGTAAGAACACATGGACACAGG - Intergenic
1163367250 19:16882357-16882379 CAGGAGGAAAAGAGAGACCTTGG - Intergenic
1163687099 19:18717850-18717872 CAGTACAAGCAGAGGGCCCCTGG + Intronic
1164222053 19:23203827-23203849 CGGGAAGGACAGAGGGACCCAGG - Intergenic
1165607881 19:37122410-37122432 CAGTGAGAACACAGGGACACAGG + Intronic
1166566573 19:43769209-43769231 CAGTAGAAACCCAGGTACCCAGG + Intronic
1166597134 19:44059825-44059847 CAGTACCATCAGAAGGACCCTGG + Intronic
1166683728 19:44782584-44782606 GAGTGGGAACAGAGGTACCCAGG + Intronic
1167383931 19:49153274-49153296 CAGTAGCCACACAGGGACCCTGG + Exonic
1202635859 1_KI270706v1_random:43558-43580 CAATGGGAACACAGGGACACAGG + Intergenic
925128480 2:1477857-1477879 CAGGTGGGACAGAGGGGCCCCGG - Intronic
925151549 2:1618705-1618727 CAGTGGGAACAGACTGAACCAGG - Intergenic
925234402 2:2265526-2265548 CAGTGGGTACAGAGGGGACCAGG + Intronic
925435870 2:3837148-3837170 CAGTAGGAACACAAGTACACTGG + Intronic
925465959 2:4107700-4107722 CAGTAAGAAAAGAGGCAGCCCGG + Intergenic
925640300 2:5980809-5980831 GAGGAGCAATAGAGGGACCCAGG - Intergenic
925969801 2:9098428-9098450 CACAGGGAAAAGAGGGACCCAGG + Intergenic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
927063632 2:19447576-19447598 CAGTAGGATGAGAGGGACCTGGG + Intergenic
927089822 2:19701827-19701849 CAGAAGGAAGAGACGCACCCTGG - Intergenic
927426077 2:22982640-22982662 CAGTAGGAACAGAGGTCTCCAGG - Intergenic
927829796 2:26339640-26339662 CATGAGAAACAGAGGGACCATGG - Intronic
928306736 2:30176513-30176535 CAGTAGGACCAATGGGAGCCGGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930218595 2:48722587-48722609 CAGTAGGAAGAGAGAGAGCAGGG - Intronic
930365813 2:50438072-50438094 CAGTAGGAAAATAGAGCCCCAGG - Intronic
930496211 2:52147516-52147538 CAATAAGAACACAGGGACACAGG - Intergenic
930535617 2:52642718-52642740 CAGTAAGAACACATGGACACAGG - Intergenic
930551954 2:52847067-52847089 CAGTGAGAACAGATGGACACAGG - Intergenic
930673160 2:54172740-54172762 CAGTAAGAACACATGGACACAGG - Intronic
930961783 2:57271054-57271076 CAATAGGAACACATGGACACAGG - Intergenic
931051610 2:58421383-58421405 GAGTAGGAAAAGAGGAACCGGGG - Intergenic
931552818 2:63465987-63466009 AACTAGGCACAGAGGCACCCTGG - Intronic
931599649 2:63990556-63990578 CAGAAGGAGCAGAGGTATCCTGG - Intronic
933557816 2:83852053-83852075 CAGTGAGAACACAGGGACACAGG + Intergenic
934761014 2:96857307-96857329 CAATAGGAACAGAGGAAGGCGGG - Intronic
935268053 2:101411442-101411464 CAGTAGGAGCACAGGAGCCCTGG + Intronic
937661846 2:124439131-124439153 AGGAAGGAACAGAGGGATCCAGG + Intronic
938422352 2:131155265-131155287 CAGTAGCAACAGAGGGCGCGGGG + Intronic
938794347 2:134705600-134705622 CAGAAGGAACAGAGGAAGCCGGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
942401643 2:175609453-175609475 CAGTAGGAACAAAGGAAGCTGGG - Intergenic
942807351 2:179947336-179947358 CAGTAGGATCAAGGGGACGCTGG - Intronic
942864696 2:180659200-180659222 CAATGAGAACACAGGGACCCAGG - Intergenic
943209028 2:184938836-184938858 CAGTAGGACCAGTAGGACCGAGG + Exonic
943250509 2:185516141-185516163 CAGTAAGAACACATGGACACAGG - Intergenic
945006793 2:205417123-205417145 CAGTAAGAACACATGGACACAGG - Intronic
945544718 2:211136968-211136990 CAGTAGGTCCAGTGGGTCCCTGG + Intergenic
946681793 2:222224870-222224892 CAGTAGCAACAGAGGCAAACTGG + Intronic
946723835 2:222641340-222641362 CAGTAGGGCCAGATGGAACCAGG - Intronic
947074986 2:226332983-226333005 CAATAGGAACAGTGAGACCTAGG + Intergenic
947971947 2:234332125-234332147 CAGTCCGAACAGAGAGACGCAGG - Intergenic
948288487 2:236806307-236806329 CAGTAATAACTGAGGGACCGGGG + Intergenic
948356307 2:237380587-237380609 CAGTAGAAACAGAAGAACACAGG + Intronic
1169289130 20:4333529-4333551 CAGCAGGAGAGGAGGGACCCAGG - Intergenic
1169457057 20:5761203-5761225 CAGTGAGAACACAGGGACACAGG + Intronic
1169853887 20:10082645-10082667 CAGAAAGAACAGAGGTTCCCAGG + Intergenic
1169854112 20:10084779-10084801 CATATGGAACAGAGGCACCCTGG + Intergenic
1170138480 20:13101817-13101839 CAGTAGCAGCAGCGGCACCCAGG - Intronic
1172927292 20:38550091-38550113 CAGTGGGAACACATGGACACAGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1173919298 20:46731779-46731801 CTTTAGGAACACAGGGACCAGGG + Intronic
1174461844 20:50688865-50688887 CAGGATGAACTGGGGGACCCTGG + Intronic
1175313500 20:58028279-58028301 CAGTGGGAAGTGAAGGACCCAGG - Intergenic
1176336104 21:5601562-5601584 CAGGAGGATGAGAGAGACCCCGG - Intergenic
1176391653 21:6219386-6219408 CAGGAGGATGAGAGAGACCCCGG + Intergenic
1176469766 21:7096788-7096810 CAGGAGGATGAGAGAGACCCCGG - Intergenic
1176493327 21:7478566-7478588 CAGGAGGATGAGAGAGACCCCGG - Intergenic
1176507315 21:7659817-7659839 CAGGAGGATGAGAGAGACCCCGG + Intergenic
1178246362 21:30956846-30956868 CAGAAGGAACATTGGGTCCCTGG - Intergenic
1179103956 21:38381796-38381818 CTTTTGGAACAGAAGGACCCCGG - Exonic
1179974882 21:44859063-44859085 CAGCAGCACCAGAAGGACCCAGG + Intronic
1180985774 22:19903240-19903262 CAGCAGGAACAGGCAGACCCTGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181375568 22:22455164-22455186 CAGAGGGAACGGAGGGAGCCAGG + Intergenic
1181453464 22:23039008-23039030 CAGCAGGCACTGAGGGAGCCTGG - Intergenic
1181797338 22:25319785-25319807 CGGCAGGAACAGAGTGACCGAGG - Intergenic
1181854513 22:25772480-25772502 CAGAAGGCACCGAGGGCCCCCGG - Exonic
1182103600 22:27673843-27673865 CTGAAGGGACAGAGGGACCTGGG - Intergenic
1182422985 22:30257550-30257572 CAGTAGGTGCAGAGGGCCCTGGG + Intergenic
1185014605 22:48335628-48335650 CAGTGGGGACACAGGGACCTTGG - Intergenic
1185144867 22:49127129-49127151 CAGTGAGAACATAGGGACACAGG + Intergenic
949610333 3:5697714-5697736 CAGAGGGAACAGAGGGAGTCAGG - Intergenic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
952198261 3:31098537-31098559 CAGAAGGACCAAAAGGACCCTGG - Intergenic
952327571 3:32335040-32335062 CAGTAGGCACCGAGGCACTCAGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954371063 3:50169811-50169833 CAGAAGGAACAAAGGAACCTGGG - Intronic
957153548 3:76518214-76518236 CAGTATGACCTGAAGGACCCAGG + Intronic
957811093 3:85223796-85223818 CAGTAAGAACACATGGACACAGG - Intronic
958925743 3:100155368-100155390 CAATAGGAACAGAGTAAGCCAGG - Intronic
959238689 3:103759508-103759530 CAGTGGGAACACATGGACACAGG + Intergenic
959584031 3:108009234-108009256 CAGTAGACACAGAAGCACCCAGG + Intergenic
960453570 3:117841529-117841551 CAGTAGGAACACAGAGACATGGG + Intergenic
960714435 3:120561114-120561136 CAATAGGAGCAGAGGGGCCTTGG + Intergenic
961124717 3:124406624-124406646 CAGTAGGAAGAAAGGGTCCATGG - Intronic
961538607 3:127585561-127585583 CAGGTGGAACAGAGGGACTTGGG + Intronic
962395865 3:135014983-135015005 CTTTAGGAACAAAAGGACCCTGG + Intronic
963270280 3:143279608-143279630 CAATGGGAACACATGGACCCAGG - Intronic
964416496 3:156453713-156453735 CGGAAGGATCAGAGGGACTCAGG - Intronic
967770241 3:193326298-193326320 CAGAAGGGAAAGAGGGCCCCTGG - Intronic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
971285418 4:25284687-25284709 CAGTGAGAACACAGGGACACAGG - Intergenic
971740739 4:30517356-30517378 CAGTGAGAACACAGGGACACAGG + Intergenic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
976034344 4:80796973-80796995 CAGTAGGTCCAGTGGGTCCCTGG - Intronic
977852369 4:101846059-101846081 CAATAGGAACACATGGACACAGG - Intronic
980861310 4:138502381-138502403 CAGTAAGAACACATGGACACAGG - Intergenic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
981663042 4:147189826-147189848 CAGTAAGAACACAGGGACCCAGG + Intergenic
981677917 4:147361086-147361108 AACTAGGAATAGAAGGACCCAGG + Intergenic
981772647 4:148328027-148328049 CAGAGGCAACAGAGGGCCCCAGG + Intronic
982036907 4:151354763-151354785 CAGTAAGAACACATGGACACAGG - Intergenic
985856694 5:2433912-2433934 CAATAGGAACAGGTGCACCCAGG - Intergenic
985861398 5:2474005-2474027 CAATGGGAACTCAGGGACCCTGG + Intergenic
986048274 5:4062276-4062298 CATTAGCAACAGAGGCACTCTGG - Intergenic
986261749 5:6153442-6153464 CAGTGGGTCCAGAGGGTCCCTGG - Intergenic
987066296 5:14293141-14293163 CACTCGGAACAGCTGGACCCTGG + Intronic
987745692 5:21968925-21968947 CAGTAAGAACACATGGACACAGG + Intronic
987957239 5:24755922-24755944 CAATAGGAACACATGGACACAGG + Intergenic
988233437 5:28508288-28508310 CAGTAGGTTCAGTGGGTCCCTGG - Intergenic
988704352 5:33709652-33709674 CACTTGGAACACATGGACCCAGG + Intronic
990544967 5:56814459-56814481 GAGTGGGGACAGAGGGAACCCGG + Intergenic
990660810 5:58013390-58013412 TAGTTGGAAGAGAGGGAGCCTGG - Intergenic
991523156 5:67523704-67523726 CAATGAGAACAGAGGGACACAGG - Intergenic
991669532 5:69033915-69033937 AAGAAGGAACAGAGTGACCCAGG + Intergenic
991873874 5:71139420-71139442 CAGTAAGAACACATGGACACAGG - Intergenic
993266004 5:85727244-85727266 CAGTAAGAACACATGGACACAGG + Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993555217 5:89328628-89328650 CAGGAGGAAGAGAGAGAGCCGGG + Intergenic
994388163 5:99157619-99157641 CAGTGAGAACACAGGGACACAGG - Intergenic
994691625 5:103026818-103026840 TAGTAGGAACAGTGGGGCCTAGG + Intronic
997271348 5:132540933-132540955 CAAAAGGAACAGAGAGACACTGG - Intergenic
997456740 5:134023272-134023294 CAATAGGAACACATGGACACAGG + Intergenic
999089170 5:148920563-148920585 CAGATGGAAGAGAGGGAGCCAGG + Intergenic
999102295 5:149036656-149036678 CAGGGGGAACAGAGGACCCCAGG - Intronic
999249436 5:150173369-150173391 CAGTAGGTACAAAGGCCCCCAGG - Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1004147054 6:13077694-13077716 CAACAGGAACAGGGGGAGCCTGG + Intronic
1006536763 6:34705352-34705374 CAGTAGGAAAAAAGAGACCCAGG - Intergenic
1008933691 6:56966790-56966812 GAGGAGCAACAGAGGGACTCTGG + Intronic
1009512840 6:64574223-64574245 CAATGGGAACACAGGGACACAGG + Intronic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011302810 6:85894043-85894065 CAGTAAGAACACATGGACACAGG - Intergenic
1011830749 6:91368403-91368425 CAGTGAGAACACAGGGACACAGG - Intergenic
1012149013 6:95722062-95722084 CAATAGGAACACATGGACACAGG + Intergenic
1013186866 6:107766870-107766892 CATCAGCAAGAGAGGGACCCTGG + Intronic
1015104423 6:129519552-129519574 CAGGAGGATCAGTGGAACCCAGG + Intergenic
1015691617 6:135930477-135930499 TACTAGGAAAAGAGGGTCCCTGG + Intronic
1017024084 6:150166485-150166507 AAGGAGGAACAAAGAGACCCTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018273175 6:162102232-162102254 CAGTGAGAACACAGGGACACAGG - Intronic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1019539496 7:1545427-1545449 CACCAGGAACAGCGGGACCTGGG - Exonic
1020836085 7:13153389-13153411 GAGTAGGTTCAGAGGGACTCCGG + Intergenic
1022365820 7:29715072-29715094 CAGTGAGAACAGATGGACACAGG + Intergenic
1024524532 7:50336885-50336907 CAGCAGGACCACAGGGGCCCTGG + Intronic
1024874707 7:54008898-54008920 CACTTGGATCAGAGGGACCTGGG - Intergenic
1027216880 7:76189511-76189533 CAGTCGGAACACGGGGACCCAGG + Intergenic
1028533514 7:91864909-91864931 CAGTGGGAACACATGGACACAGG + Intronic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029827867 7:103219756-103219778 CAGTGAGAACAGATGGACACAGG - Intergenic
1030306200 7:108020975-108020997 GACTAGGACCAGAGGGACCATGG + Intergenic
1031676397 7:124617116-124617138 CAGTGGGTCCAGAGGGTCCCTGG + Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1033654228 7:143362409-143362431 AAGGAGGGACAGAGGGACCGCGG + Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034514811 7:151567527-151567549 TAATAGGAACAGAGGGAGCATGG - Intronic
1035085910 7:156257759-156257781 CAGGAGGAAGAGAGGGACGGGGG + Intergenic
1035274270 7:157737930-157737952 CAGCAGGGACAGAGGCTCCCGGG + Intronic
1035319234 7:158017757-158017779 CAGCAGGGACAGAAGGACGCAGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1037079963 8:14772622-14772644 CAGTGAGAACACATGGACCCAGG - Intronic
1037927270 8:22853567-22853589 AGGTAGGAATAGAGGGAACCAGG + Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041892549 8:62886860-62886882 CAATGAGAACACAGGGACCCAGG - Intronic
1043529900 8:81137624-81137646 ATGTAGGAAAATAGGGACCCAGG + Intergenic
1043602114 8:81952934-81952956 CAGGAGGATCAGTGGGACCTGGG + Intergenic
1043749004 8:83911528-83911550 CAGCAGAAACAGAGGAATCCTGG - Intergenic
1043994556 8:86796814-86796836 CAGAAGGAACACTTGGACCCGGG + Intergenic
1045866076 8:106866976-106866998 GAGAAGGAACAGAGGGAGTCAGG + Intergenic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1048378783 8:133845853-133845875 CAGGAAGAACATAAGGACCCTGG - Intergenic
1050198979 9:3121058-3121080 CAGTAAGAACACATGGACACAGG - Intergenic
1052398142 9:27966517-27966539 CAGTGGGAACACATGGACACAGG + Intronic
1052753288 9:32514522-32514544 CAGTAAGAACACATGGACACAGG + Intronic
1052851266 9:33379959-33379981 CAGTAGGAACAGTGAAACTCAGG - Intergenic
1054801801 9:69357160-69357182 AAGGAGGGACTGAGGGACCCGGG + Intronic
1054942592 9:70759780-70759802 CAGTAAGAACACATGGACACAGG + Intronic
1055315036 9:75026565-75026587 TAGTAGTAACAGAGGGAGCAAGG - Intronic
1055433027 9:76263575-76263597 CAATAGGAACACATGGACACAGG + Intronic
1058961908 9:109999489-109999511 CACTGGGAACAGATGGTCCCAGG - Intronic
1059447948 9:114350725-114350747 TGGTAGGAGCAGACGGACCCAGG - Intronic
1059501354 9:114756779-114756801 CCGTAGGTACAGTGGGCCCCAGG + Intergenic
1060097470 9:120804887-120804909 CAGGAGGACCAGAGAGACCTTGG + Intergenic
1061997523 9:134194073-134194095 CAGTAGACACAGAGCTACCCAGG + Intergenic
1062096735 9:134707545-134707567 GAGTGGGAACAGAGGAGCCCTGG + Intronic
1203425538 Un_GL000195v1:33340-33362 CAGGAGGATGAGAGAGACCCCGG + Intergenic
1185644905 X:1609582-1609604 CAGTAGGAACAGGGGTGGCCTGG - Intergenic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1186038499 X:5450080-5450102 TATTAGGAACAGGGGCACCCTGG - Intergenic
1187284842 X:17895178-17895200 CAGCAGGAACAGAAGTATCCTGG - Intergenic
1189342505 X:40215124-40215146 CAGTAGGATCACTGGGGCCCAGG + Intergenic
1190556161 X:51637626-51637648 CAGCAGTAACAGGGGGACCCAGG - Intergenic
1190622106 X:52297717-52297739 CAATTGGAACACATGGACCCAGG + Intergenic
1191702444 X:64057695-64057717 CAATGGGAACACATGGACCCTGG - Intergenic
1193591136 X:83390010-83390032 CAGGAGGACCAGAGTGACCTAGG - Intergenic
1196011379 X:110891662-110891684 CAATAAGAACACATGGACCCAGG + Intergenic
1196283964 X:113857956-113857978 CAGTGGGAACACATGGACACAGG - Intergenic
1198817070 X:140602939-140602961 AAATAGGAACAGAGGGAACTTGG - Intergenic
1201371871 Y:13274295-13274317 CAGTAAGAACACATGGACACAGG - Intronic
1202124851 Y:21558347-21558369 CAATAAGAACACAGGGACACAGG + Intergenic
1202154157 Y:21871033-21871055 CAATAAGAACACAGGGACACAGG - Intergenic