ID: 1029114119

View in Genome Browser
Species Human (GRCh38)
Location 7:98228707-98228729
Sequence CCCTGGCTCCTAGAAATCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029114113_1029114119 -5 Left 1029114113 7:98228689-98228711 CCAGTAGGAACAGAGGGACCCTG 0: 1
1: 1
2: 0
3: 16
4: 169
Right 1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1029114107_1029114119 26 Left 1029114107 7:98228658-98228680 CCGTTTCAGTGTCTGTTTCCGCC 0: 1
1: 0
2: 2
3: 18
4: 239
Right 1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1029114110_1029114119 5 Left 1029114110 7:98228679-98228701 CCTTCGTTTTCCAGTAGGAACAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1029114109_1029114119 8 Left 1029114109 7:98228676-98228698 CCGCCTTCGTTTTCCAGTAGGAA 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1029114106_1029114119 27 Left 1029114106 7:98228657-98228679 CCCGTTTCAGTGTCTGTTTCCGC 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1029114105_1029114119 28 Left 1029114105 7:98228656-98228678 CCCCGTTTCAGTGTCTGTTTCCG 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029114119 Original CRISPR CCCTGGCTCCTAGAAATCGG GGG Intronic
900528520 1:3141066-3141088 CCTTGGCTCCCAGAACTCTGGGG + Intronic
900736217 1:4301021-4301043 CCCTGGCCTGTAGAAATAGGTGG + Intergenic
914000655 1:143691813-143691835 TCCTGGCACCCAGCAATCGGAGG + Intergenic
914197973 1:145460009-145460031 TCCTGGCACCCAGCAATCGGAGG + Intergenic
914477075 1:148033141-148033163 TCCTGGCACCCAGCAATCGGAGG + Intergenic
1065695886 10:28379399-28379421 CACTGGGTCCTAGAGATCGCAGG + Intergenic
1067556799 10:47278399-47278421 ACCTGGCTCCTGGAAATAAGAGG + Intergenic
1067709003 10:48633909-48633931 CCCTGACTCCTGGAAATCTCTGG + Intronic
1072607569 10:96997596-96997618 CAGTGGCTCTTAGAAATTGGTGG - Intergenic
1073098639 10:100995817-100995839 CCCTGGATTCTAGAAAGCAGTGG + Intergenic
1074332896 10:112536938-112536960 CCCTGGCTGCTAGAGCTTGGAGG + Intronic
1077489047 11:2852074-2852096 CCCTGGGTCCTAGAGCCCGGAGG - Intergenic
1082807178 11:57458688-57458710 TCCTGCCTCCTGGAAATAGGGGG + Intergenic
1085198704 11:74688353-74688375 GCCTGGGTCCTGCAAATCGGAGG - Intergenic
1090670626 11:128942792-128942814 ACCTGCCTCCTAGGAGTCGGAGG + Exonic
1098058936 12:66539352-66539374 CCCTGCCTCCTAGGAGACGGTGG + Intronic
1107430838 13:40338704-40338726 CCTTGGCTCCCAGAAACCGCAGG - Intergenic
1110688826 13:78407237-78407259 CCCTGACTCATAGATATCTGAGG - Intergenic
1113949815 13:114065717-114065739 CCCTGGCTCCCAGAGGTCAGAGG + Intronic
1114127570 14:19747739-19747761 CACTGGCTCCTAGAAAGTGGAGG - Exonic
1122212771 14:100183360-100183382 CGCTGGCTCCTAGATGTCTGTGG - Intergenic
1123571021 15:21609412-21609434 CACTGGCTCCTAGAAAGTGGAGG - Intergenic
1123607133 15:22044769-22044791 CACTGGCTCCTAGAAAGTGGAGG - Intergenic
1124031831 15:26019071-26019093 CCCTGGGTTCTAGAACTCAGGGG - Intergenic
1202979373 15_KI270727v1_random:336536-336558 CACTGGCTCCTAGAAAGTGGAGG - Intergenic
1132534661 16:472128-472150 CCCTGACTCCTCGAAAGCTGAGG + Intronic
1132601337 16:774479-774501 CCCTGGCTCCTGGACACTGGAGG - Exonic
1143526980 17:7478846-7478868 CCCTGGCTGCCAGCAAACGGTGG + Intronic
1147230395 17:39013465-39013487 CCCTGACTCCTAGAAGTATGAGG + Intergenic
1151763609 17:76121434-76121456 CCCGGGGTTCTAGAAAGCGGAGG - Intronic
1151905169 17:77043224-77043246 CAATGGTTCCCAGAAATCGGTGG - Intergenic
1152449877 17:80371393-80371415 GCCTGGCTCCTGGAAGTCAGCGG - Intronic
1161347190 19:3774315-3774337 CCCTGGCTCCTTGGACTTGGGGG - Intergenic
1162405291 19:10469442-10469464 CCCTGGCTCCTGGAGAAGGGGGG - Exonic
1167096229 19:47376314-47376336 CCCTGACTCCTCCAAATCTGGGG - Intronic
925282448 2:2694321-2694343 CCCAGGCACCTGGAAAACGGGGG + Intergenic
928739807 2:34338154-34338176 CCCTTTCTCCTATAAATCTGTGG + Intergenic
929052687 2:37851384-37851406 CCCTGGCACCGAGAAGTAGGTGG + Intergenic
931466484 2:62492059-62492081 CCTTGGCCCCTAGAAGTCGGAGG + Intergenic
940330370 2:152467472-152467494 CCCTGTTTCCTACAAATCGAAGG + Intronic
940959854 2:159773100-159773122 CCCTGGCACCCAGAAGGCGGAGG - Intronic
943639855 2:190345908-190345930 CCCTGGAACCTAGGAATCAGAGG + Intronic
946429770 2:219619084-219619106 CTCTGGCTCCTGGAAAGCAGTGG + Intergenic
1170729557 20:18961410-18961432 CCCTGGATCCTGGCAATCAGAGG + Intergenic
1177281854 21:18990880-18990902 CCCTGGCTCACAGAAAACTGTGG - Intergenic
1178774880 21:35540367-35540389 CCCTGGAACCTGGAAATAGGAGG - Intronic
1179117781 21:38509872-38509894 CATTAGCTCCTAGAAATCAGAGG + Intronic
1180037206 21:45256117-45256139 CCCTGACTCCAAGAGAACGGGGG + Intergenic
1182904226 22:33921779-33921801 CCCTGGTCCCTAGAACTGGGAGG - Intronic
949879109 3:8647983-8648005 CCCTGGCTCCCAGAGAGAGGAGG - Intronic
950106116 3:10389899-10389921 CCCTCGCTGCTAGAACTGGGTGG - Intronic
954648665 3:52146369-52146391 GCCTGTCTCCTAGAAAGGGGTGG - Intronic
955205398 3:56891380-56891402 TCCTGGATCCTAGAAAAAGGAGG - Intronic
967745874 3:193054300-193054322 CCCTCTCTCCTATAAATCGGAGG - Intergenic
969031802 4:4221578-4221600 CCCAGGCTCCTAGAAGTTGAGGG + Intronic
969211012 4:5687303-5687325 CCCGGGCTCCTGGTAATAGGAGG - Intronic
977362234 4:96020835-96020857 CCATGGCTACTAGAAATAAGAGG - Intergenic
977634937 4:99286474-99286496 CCCAGACACCTAGAAATGGGAGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
980483643 4:133424392-133424414 TCCTGGCTACTAGAAATTGCTGG + Intergenic
986824004 5:11501245-11501267 CCTTGGCTCCCAGGAATGGGTGG - Intronic
992373215 5:76166586-76166608 CCCTAGCTCCTAGATATTTGTGG - Intronic
992896172 5:81246834-81246856 CCCTGGCTGCTAGATATCACAGG - Intronic
997653948 5:135541890-135541912 CCATGGTTTCTAGAAATCCGTGG + Intergenic
1002770667 6:288196-288218 CCCTGGTTCCTAAAATTTGGAGG - Intergenic
1004233257 6:13851542-13851564 CCCAGATTCCTAGAAATGGGAGG - Intergenic
1004557505 6:16713779-16713801 GCCTGGCGCCCAGAAATCTGTGG + Intronic
1006981528 6:38151820-38151842 TCCTGCCTCCTAGAAATGGTGGG + Intronic
1019580026 7:1757149-1757171 CCCTGGCTCCCAGATGTCTGTGG - Intergenic
1022382245 7:29871325-29871347 CCCTGTCTCCTAAAACTTGGGGG - Intronic
1024570595 7:50719922-50719944 CTCTGGCACCTAGAAATAGCTGG + Intronic
1025996027 7:66528146-66528168 CCCTGGCCCCCAGAAATCCCTGG - Intergenic
1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG + Intronic
1032500340 7:132395211-132395233 TCCAGGCTCCTAGAAATCACTGG + Intronic
1036780484 8:11643692-11643714 CCCAGGCTCCAAGAATTCTGGGG - Intergenic
1041874914 8:62676795-62676817 CACTGGAGCCTGGAAATCGGAGG - Intronic
1041933085 8:63308609-63308631 CCCTGGCTTCTGGAACTCTGCGG - Intergenic
1049421285 8:142517725-142517747 CCCAGGCTTCGAGAAATCCGGGG - Intronic
1051360229 9:16275653-16275675 GCCTCCCTCCTAGAAATCGCTGG + Intronic
1059653867 9:116339448-116339470 CACTGGCGCCTAGAAATCCAGGG + Intronic
1059892488 9:118818335-118818357 CCCTGGCTTCTGGAAATATGTGG - Intergenic
1185850902 X:3485776-3485798 CCCAGGCTCCTGAGAATCGGGGG + Intergenic
1189510035 X:41653218-41653240 CCCTGGCTCACAGAAATATGTGG + Intronic
1194329274 X:92560811-92560833 TCCTGGCTCCTAGACATCACTGG + Intronic
1200637973 Y:5680000-5680022 TCCTGGCTCCTAGACATCACTGG + Intronic