ID: 1029116660

View in Genome Browser
Species Human (GRCh38)
Location 7:98241169-98241191
Sequence CCTCCCCGGGGGTGTCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 20, 3: 19, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029116651_1029116660 15 Left 1029116651 7:98241131-98241153 CCACAGGAGGTCGTGGGGCCCAC 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG 0: 1
1: 0
2: 20
3: 19
4: 199
1029116644_1029116660 28 Left 1029116644 7:98241118-98241140 CCCAGAGTGTGGCCCACAGGAGG 0: 1
1: 0
2: 3
3: 35
4: 293
Right 1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG 0: 1
1: 0
2: 20
3: 19
4: 199
1029116652_1029116660 -3 Left 1029116652 7:98241149-98241171 CCCACAGCTGATCTGAACCACCT 0: 1
1: 0
2: 2
3: 14
4: 132
Right 1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG 0: 1
1: 0
2: 20
3: 19
4: 199
1029116653_1029116660 -4 Left 1029116653 7:98241150-98241172 CCACAGCTGATCTGAACCACCTC 0: 1
1: 0
2: 0
3: 46
4: 339
Right 1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG 0: 1
1: 0
2: 20
3: 19
4: 199
1029116646_1029116660 27 Left 1029116646 7:98241119-98241141 CCAGAGTGTGGCCCACAGGAGGT 0: 1
1: 0
2: 3
3: 36
4: 214
Right 1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG 0: 1
1: 0
2: 20
3: 19
4: 199
1029116650_1029116660 16 Left 1029116650 7:98241130-98241152 CCCACAGGAGGTCGTGGGGCCCA 0: 1
1: 1
2: 0
3: 10
4: 136
Right 1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG 0: 1
1: 0
2: 20
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029116660 Original CRISPR CCTCCCCGGGGGTGTCCAGC AGG Exonic