ID: 1029116663

View in Genome Browser
Species Human (GRCh38)
Location 7:98241173-98241195
Sequence GGTCCCTGCTGGACACCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029116663_1029116676 30 Left 1029116663 7:98241173-98241195 CCCGGGGGTGTCCAGCAGGGACC 0: 1
1: 0
2: 2
3: 33
4: 238
Right 1029116676 7:98241226-98241248 CGTCCTCTCTGTACCACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1029116663_1029116668 -8 Left 1029116663 7:98241173-98241195 CCCGGGGGTGTCCAGCAGGGACC 0: 1
1: 0
2: 2
3: 33
4: 238
Right 1029116668 7:98241188-98241210 CAGGGACCAGGAGGACCCTTCGG 0: 1
1: 0
2: 2
3: 29
4: 229
1029116663_1029116673 3 Left 1029116663 7:98241173-98241195 CCCGGGGGTGTCCAGCAGGGACC 0: 1
1: 0
2: 2
3: 33
4: 238
Right 1029116673 7:98241199-98241221 AGGACCCTTCGGGGTTGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 120
1029116663_1029116669 -7 Left 1029116663 7:98241173-98241195 CCCGGGGGTGTCCAGCAGGGACC 0: 1
1: 0
2: 2
3: 33
4: 238
Right 1029116669 7:98241189-98241211 AGGGACCAGGAGGACCCTTCGGG 0: 1
1: 0
2: 1
3: 22
4: 209
1029116663_1029116672 -2 Left 1029116663 7:98241173-98241195 CCCGGGGGTGTCCAGCAGGGACC 0: 1
1: 0
2: 2
3: 33
4: 238
Right 1029116672 7:98241194-98241216 CCAGGAGGACCCTTCGGGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1029116663_1029116670 -6 Left 1029116663 7:98241173-98241195 CCCGGGGGTGTCCAGCAGGGACC 0: 1
1: 0
2: 2
3: 33
4: 238
Right 1029116670 7:98241190-98241212 GGGACCAGGAGGACCCTTCGGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029116663 Original CRISPR GGTCCCTGCTGGACACCCCC GGG (reversed) Exonic
900309240 1:2025359-2025381 GGTCGATGCTGGCCACCTCCAGG - Exonic
900413014 1:2521584-2521606 TGTCCCTGCTAGAAACTCCCAGG + Intronic
904033014 1:27544849-27544871 GTTCCCTGCTGGAATTCCCCAGG - Intronic
904389492 1:30172572-30172594 AATCCCTGCTCGAAACCCCCAGG - Intergenic
904893749 1:33798790-33798812 GGACCCTGGAGGACACCCACTGG + Intronic
907328605 1:53657082-53657104 GGTCCCTGTTTGCCACCCCCGGG + Intronic
914346946 1:146808076-146808098 ACTCCCTGCTGGACACCCAGAGG + Intergenic
915321979 1:155061313-155061335 GGCCCCTGCTGGCCCCCCCTGGG + Intronic
915466088 1:156098899-156098921 GGAACCTGCTGCCCACCCCCAGG - Intronic
916654625 1:166863449-166863471 GGGCCCAGCTGGACATCACCAGG + Intronic
918004143 1:180526034-180526056 TGTCCCTCCTTGGCACCCCCAGG + Intergenic
919775562 1:201192017-201192039 GGACCCAGCTGGACACGGCCAGG - Intronic
920057503 1:203203093-203203115 GGTCCAGTCTGGACACACCCTGG + Intergenic
921356792 1:214292195-214292217 GCTTCCTGATGGACACCCTCAGG + Intronic
922571960 1:226639680-226639702 GGTCCCTGCTGACCCCCTCCTGG - Intronic
922787530 1:228290398-228290420 GTGCCCTGCTGGACCCCCTCTGG + Intronic
922816483 1:228452967-228452989 GGGCCCTGCTGGTCACCTGCTGG - Intergenic
1063100256 10:2944353-2944375 TGTCCCCGCCGGACACCACCAGG - Intergenic
1063355625 10:5395820-5395842 GGTTCCTGCTGGAGGCCCCAGGG + Intronic
1065593002 10:27284679-27284701 GGACCCTGCCAGCCACCCCCTGG - Intergenic
1068752212 10:60607936-60607958 GGTCCCAGCTGGTCACTCTCAGG - Intronic
1069364249 10:67680228-67680250 GGCCTCTGCTTGAGACCCCCTGG - Intronic
1069623600 10:69852988-69853010 CGCCCCAGCTGGACAGCCCCAGG - Intronic
1069703280 10:70441433-70441455 GCGCCCTGCTGGGCACCCCCGGG - Intronic
1072888062 10:99297727-99297749 GTTCACTGCTGGCCACCCCCTGG + Intergenic
1073918353 10:108431450-108431472 GGTACCTGCTGATCACCCCGAGG + Intergenic
1074492012 10:113946803-113946825 GTTCCCTGCTGGATCCCCCAAGG + Intergenic
1075444585 10:122504648-122504670 TGTCCCTGGTGGACCTCCCCTGG + Intronic
1075477944 10:122752833-122752855 GTTCACTGCTAGACACCTCCTGG - Intergenic
1075701055 10:124469734-124469756 GTTCACTGCTGCACATCCCCAGG - Intronic
1075710272 10:124527020-124527042 GGGCTCTGCTGGATGCCCCCAGG + Intronic
1076639605 10:131905243-131905265 GCTTCCTGCTGGAAGCCCCCTGG - Intronic
1076912994 10:133401707-133401729 TGTCCCCGCTGAGCACCCCCGGG + Intronic
1077229297 11:1451426-1451448 GGCCCCTGCTGGAGGCCTCCTGG + Intronic
1077502844 11:2917050-2917072 GGTCCCTCCTGGTCCTCCCCAGG - Intronic
1077534980 11:3119722-3119744 GGGACCACCTGGACACCCCCAGG + Intronic
1078181647 11:9016685-9016707 GGCCCCTACTGGCCACTCCCAGG + Intergenic
1083324183 11:61865256-61865278 GGGCCCTGCTGGACATCATCAGG + Exonic
1083405845 11:62456564-62456586 TGACCCTGGTGGACACTCCCTGG + Intronic
1083682680 11:64358693-64358715 GGGCCCTGCTGGCCACCCCCAGG + Intergenic
1084329720 11:68423380-68423402 GGGCACTGGTGGAGACCCCCGGG - Intronic
1084456390 11:69270293-69270315 GGTCCCTGTGGGACTCCCTCCGG - Intergenic
1084536369 11:69759676-69759698 GGTCCCTGCAGGACCTCCCAAGG - Intergenic
1084943158 11:72625149-72625171 GGTTCCTGCTGGCCAGCCTCTGG - Intronic
1085409880 11:76284608-76284630 TGGACCTGCTGGGCACCCCCAGG + Intergenic
1085726251 11:78957443-78957465 GGACCTTGGTTGACACCCCCAGG + Intronic
1090026139 11:123169091-123169113 GGTCCCTGCTGGGGAATCCCTGG + Intronic
1092290978 12:7159278-7159300 GCTCCCTGCTGGGCGGCCCCAGG + Intergenic
1096052920 12:48627200-48627222 GGTCCCGGCTGGGCACCAACAGG - Intergenic
1096498279 12:52051083-52051105 GGTCCCAGCTGGGGGCCCCCAGG - Intronic
1096595382 12:52691859-52691881 GTTCTCTGCTGGCCACCTCCTGG + Intronic
1097065082 12:56315161-56315183 GGGCCCTGCTGGGAACCGCCTGG - Exonic
1097778800 12:63679755-63679777 GGTCCCAGCTGGCCACTCACAGG - Intergenic
1101966892 12:109287839-109287861 GGTACCTGCTGGGCACCCGGGGG + Exonic
1102961973 12:117099058-117099080 GGTCCCCGCTGGCCACCTCGCGG - Intronic
1103711722 12:122917797-122917819 GGTCCATGCTGGGCACGCCCTGG - Intergenic
1103905786 12:124326635-124326657 GGTCGCTGCAGGACAGCCCAGGG - Intronic
1104957702 12:132474484-132474506 GGCCTCTGCTGGACGCCCACCGG - Intergenic
1104981107 12:132573480-132573502 GGTCCCTGCTCGACACCTGCAGG - Intronic
1108177514 13:47808577-47808599 GGTTCCTGCTGGACTCACCAAGG + Intergenic
1113883417 13:113642693-113642715 GGGCCCTGCAGGACACCATCAGG + Intergenic
1114832690 14:26164144-26164166 GGTCCTTGCTGGCCACCCACTGG - Intergenic
1119861638 14:77940355-77940377 GGCCCCTGCTGGGCACCAACAGG - Intergenic
1120583202 14:86279676-86279698 GGGCCCTGCTGCACAACCTCAGG + Intergenic
1120887061 14:89460009-89460031 GGTCCCTGCTGGAATTCTCCTGG + Intronic
1122116004 14:99527587-99527609 GATCCCTGCTGGACAGGGCCTGG - Intronic
1123115791 14:105893477-105893499 GGCCCCTGCTGTGCAGCCCCAGG - Intergenic
1123117821 14:105902584-105902606 GGCCCCTGCTGCGCAGCCCCAGG - Intergenic
1123120035 14:105912192-105912214 GGCCCCTGCTGTGCAGCCCCAGG - Intergenic
1123475843 15:20592247-20592269 GGTCCTTCCTGGCCATCCCCAGG - Intergenic
1123629418 15:22250913-22250935 GGTATCTGCTGGCCTCCCCCAGG + Intergenic
1123642168 15:22408116-22408138 GGTCCTTCCTGGCCATCCCCAGG + Intergenic
1124874574 15:33579908-33579930 GGGCCCTGATGAACACCCACTGG - Intronic
1125522485 15:40356109-40356131 GGTCACTGCGGGCCACCCCCTGG + Exonic
1125522515 15:40356175-40356197 GGGCCCTGCGGGCCACCCCCTGG + Exonic
1125522547 15:40356241-40356263 GGGCCCTGCGGGCCTCCCCCTGG + Exonic
1127574682 15:60279451-60279473 GGTCCCTGTGGGACACCCAGTGG + Intergenic
1128355085 15:66920714-66920736 GGTCCCTGTTGGGCCCCCTCAGG - Intergenic
1131060277 15:89400120-89400142 GGTCTCTGCTGGGCCCCGCCCGG - Intergenic
1132602407 16:779554-779576 GGCACCTGCTGGGCAGCCCCGGG + Intronic
1132725041 16:1334772-1334794 GATTCCTGCGGGAAACCCCCAGG + Intronic
1133240180 16:4409490-4409512 GGTCCCTGCGTGTCAACCCCTGG - Intronic
1134110778 16:11514325-11514347 CTTCCCTGGTGGCCACCCCCTGG - Intronic
1134134545 16:11670084-11670106 GGGCACTGCTGGACACAGCCAGG - Intronic
1135772681 16:25229212-25229234 GGACCCTGCTGAAAACCCCCAGG + Intergenic
1137590079 16:49687989-49688011 GGTCCCTCCTGGAGGCCCTCTGG - Intronic
1137621661 16:49880341-49880363 GCTCCCAGCTGGCCACCCACAGG - Intergenic
1138246524 16:55470844-55470866 GGTCCCTGCGTGCCACCCCTTGG + Intronic
1139373685 16:66483837-66483859 CGTCCCTGCTGGACAGGCCAAGG + Intronic
1139987036 16:70907194-70907216 ACTCCCTGCTGGACACCCAGAGG - Intronic
1140486820 16:75300042-75300064 CTTCCCTGCGGAACACCCCCGGG - Intronic
1141428620 16:83959372-83959394 GGTCCAGGATGGAGACCCCCGGG - Exonic
1141974140 16:87503523-87503545 GGTATCTGCTGGCCTCCCCCAGG - Intergenic
1143271414 17:5678285-5678307 GGTGCCTGCTGGACCCCTGCAGG + Intergenic
1143375463 17:6464407-6464429 GGTCCCTGCCTGACATTCCCTGG + Intronic
1143950698 17:10630270-10630292 GGTTCCTCCTGCACACACCCTGG + Exonic
1144651359 17:17009242-17009264 GGTCCCAGCTGGTCTCCCCAAGG + Intergenic
1144714122 17:17422370-17422392 CGTCCCTCCTGGCCACACCCTGG + Intergenic
1144992756 17:19245165-19245187 GGTCCCTGCTGTACACATCCAGG - Intronic
1145066741 17:19766538-19766560 GGTCCCTGCTGGCGACCCCTTGG + Intergenic
1145103481 17:20095958-20095980 GGTCCCTGCTGGCCAGTCTCGGG + Intronic
1146274752 17:31509596-31509618 GGTCCCTCCCTGACACCCCGGGG + Intronic
1146400158 17:32495342-32495364 GGTCCCTGCCTGTCACACCCCGG + Intronic
1147301373 17:39530989-39531011 GGTAACTGCTGGACTCCCCAAGG - Exonic
1147575496 17:41596543-41596565 GGGCCCTGCTGGAAGCTCCCAGG - Intergenic
1148481321 17:47961299-47961321 CGACCAGGCTGGACACCCCCAGG - Intergenic
1149638626 17:58189478-58189500 GGTCCAGGCTGGAAAGCCCCTGG + Intergenic
1149651061 17:58276725-58276747 GGTTCCTGCTGGTCTCTCCCTGG - Intronic
1150514916 17:65798092-65798114 GGTCCCTTCTGGAATCCCACTGG + Intronic
1151555841 17:74846341-74846363 TGAGCCTGCTGGGCACCCCCGGG + Intronic
1152739501 17:82012743-82012765 GGTCCCTGCTAGGAACGCCCTGG + Intronic
1153920207 18:9782251-9782273 TAACCCTGCTGGCCACCCCCAGG + Intronic
1157148626 18:45191735-45191757 GGTGTCTGCTTGACACCCCTAGG - Intergenic
1157701334 18:49762964-49762986 GGTCTCTGCAGGCCACCCCTGGG + Intergenic
1158478741 18:57802924-57802946 GGAACCTGCAGGACACCGCCGGG + Intronic
1160597892 18:79989603-79989625 GGTTCATGCTGGAGACTCCCTGG + Intronic
1161887173 19:7005892-7005914 GGTCCCTGCAGTACAGACCCTGG + Intergenic
1162110533 19:8397474-8397496 GGTGCCTGCTGCACAGGCCCGGG + Intronic
1162500783 19:11052443-11052465 GGACCCTCCTTCACACCCCCTGG - Intronic
1163426079 19:17241661-17241683 GGTTCCAGCTGGACACCCAGGGG + Intronic
1163444458 19:17338507-17338529 GGTCCCAGTCTGACACCCCCTGG - Intronic
1164189530 19:22901677-22901699 GGACCCAGATGGCCACCCCCGGG - Intergenic
1165354247 19:35293915-35293937 GGTCCCTGCCCGCCACCCCCAGG + Intronic
1167314900 19:48757495-48757517 GGTCCCTGCAGGAGAGCCCTGGG + Intronic
1167503766 19:49861060-49861082 GGTCCCAGCTGGACTCCCCTCGG + Intergenic
1167512686 19:49904403-49904425 GATCCCTCCTAGACTCCCCCAGG + Intronic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
925589216 2:5493455-5493477 GGTCCCTGATAGACAGCACCGGG + Intergenic
925838216 2:7966112-7966134 GCACCCTGCTGCACACCCCCTGG + Intergenic
927054574 2:19356955-19356977 GGTTGCTGCTGGGCTCCCCCAGG - Intronic
927095566 2:19745512-19745534 GGTGCCTGCAGAACACCCACAGG + Intergenic
927911872 2:26905488-26905510 GGTGCCTGCTGGCCAAGCCCAGG - Intronic
928663432 2:33527078-33527100 TTTCCCTCCTGCACACCCCCGGG - Intronic
931257506 2:60585939-60585961 GGTCACTGCTGGACACCCAGTGG - Intergenic
936261820 2:110966343-110966365 GCTCCCTGCTGGACCCCTGCTGG - Intronic
937346568 2:121129822-121129844 TGAACCTGCTGGACACCACCTGG + Intergenic
937910258 2:127072195-127072217 GGTCCCTGCTGGCCTTCACCTGG - Intronic
939660838 2:144887600-144887622 GTTGCCTGCTGGGCACCCACAGG - Intergenic
942261726 2:174171959-174171981 TGTCCCAGCTGGAGACCGCCGGG - Intronic
944480634 2:200154082-200154104 GCTCACTGCTGCTCACCCCCAGG - Intergenic
946373574 2:219294974-219294996 GGCCCCTGCTGGACTTCCGCAGG - Exonic
946432087 2:219631403-219631425 GGCCCCTGATGGACTCCCACAGG - Intronic
947720867 2:232368485-232368507 GGTCCCTGCAGGAGGACCCCAGG - Intergenic
947733761 2:232444542-232444564 AGTCACTGCTGGGCACCACCAGG - Intergenic
947958553 2:234215402-234215424 GGACACAGCTGGACACCCACAGG - Intergenic
947984358 2:234436408-234436430 GGGCCATGCTGGACTCCACCGGG - Intergenic
948461145 2:238130582-238130604 GGCCCCTGCAGGACACCTGCAGG + Exonic
948525235 2:238567254-238567276 GGTCCCCTCTGTACACCGCCCGG + Intergenic
1173384077 20:42572366-42572388 GGCCTCTGCTGGCCACCCTCTGG + Intronic
1173646694 20:44637704-44637726 GTTCCCTGCTGGCCTCCCCTGGG - Intronic
1173930229 20:46811617-46811639 GGTGCCTGCTGTCCGCCCCCCGG - Intergenic
1174001590 20:47378817-47378839 GGTCCCTGCAGGGCACTCCGAGG - Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1175851540 20:62096716-62096738 GGTCCCTGCCGCAGGCCCCCAGG - Intergenic
1176025039 20:62981519-62981541 GGTTCCTGCTGGACTCCCCTCGG + Intergenic
1176161721 20:63652029-63652051 GCCTCCTCCTGGACACCCCCGGG - Intronic
1176667741 21:9703219-9703241 AGACACTGCTGGAAACCCCCAGG + Intergenic
1178405828 21:32322617-32322639 GGCCCCAGCAGGACGCCCCCTGG + Intronic
1178765123 21:35443261-35443283 GGACCCTGCTGCCCACTCCCTGG - Intronic
1179507770 21:41853054-41853076 GGTCCCTTCTGGGCACCCTGAGG - Intronic
1180762575 22:18221150-18221172 GGTCCTTGCTGGATCCCACCTGG - Intergenic
1180773092 22:18403458-18403480 GGTCCTTGCTGGATCCCACCTGG + Intergenic
1180804448 22:18653007-18653029 GGTCCTTGCTGGATCCCACCTGG + Intergenic
1180806303 22:18716403-18716425 GGTCCTTGCTGGATCCCACCTGG - Intergenic
1180921020 22:19521736-19521758 GGTCCCTGTTGTACAGGCCCAGG + Intergenic
1181217249 22:21342184-21342206 GGTCCTTGCTGGATCCCACCTGG - Intergenic
1181603706 22:23967237-23967259 GGTCCCTGAAGGTCACGCCCGGG - Intronic
1181604807 22:23974070-23974092 GGTCCCTGAAGGTCACGCCCGGG + Intronic
1183345160 22:37303432-37303454 GGTCCCTCCTGGATTCCCCGGGG - Intronic
1184151968 22:42644597-42644619 GGTCCCTTCTGGAAACTCCCTGG + Intronic
1184239073 22:43202325-43202347 GGTTCCTCCTGGTCACCCCCGGG - Exonic
1184351388 22:43946234-43946256 GGTCTCTGCTGGACAGCCCTTGG - Exonic
1184417238 22:44359435-44359457 TGTCCCTGATGGACACCCAGAGG - Intergenic
1184746257 22:46457981-46458003 GGTGCCTGCTGCAGACCCGCGGG + Intronic
1185342330 22:50297234-50297256 ACTCCCTGCAGCACACCCCCAGG + Intronic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
1203234925 22_KI270731v1_random:144440-144462 GGTCCTTGCTGGATCCCACCTGG + Intergenic
950362911 3:12462428-12462450 GGTCCCTGCTCCCCACCCCCAGG + Intergenic
950533203 3:13565088-13565110 TGTCCCTGCTGGACACTCCCTGG + Intronic
950863858 3:16173708-16173730 GGACCATGCAGGACACCCCCTGG - Intergenic
953410911 3:42690090-42690112 GGGTCCTTTTGGACACCCCCAGG - Intronic
953515446 3:43586444-43586466 GTTCCCTGCTGGAAGCCCCTAGG + Intronic
954394536 3:50286550-50286572 GGTCGCTGATGGACTCCACCTGG - Exonic
954635441 3:52068510-52068532 GGCCCCTGCAGGAGGCCCCCAGG + Intergenic
954854013 3:53627209-53627231 GATCCCTGCTGCACAGCCTCTGG + Intronic
954941169 3:54374632-54374654 GGTTGTTGCTGGACACCCCCTGG + Intronic
955927668 3:64023551-64023573 GTCCTCTGCTGGACACCTCCGGG + Intronic
956059408 3:65334453-65334475 GCCCCCAGCTGGACACCCCCAGG - Intergenic
961076983 3:123991826-123991848 GAGCCCTGCCGGACGCCCCCTGG - Intronic
961307593 3:125969474-125969496 GAGCCCTGCCGGACGCCCCCTGG + Intronic
961322069 3:126083491-126083513 ACTCCCGGCTGGGCACCCCCAGG + Intronic
961514133 3:127422526-127422548 TGTCCCTCTGGGACACCCCCTGG - Intergenic
968503865 4:963121-963143 GGGTCCTGCTGGACTCACCCGGG + Exonic
969069469 4:4523477-4523499 GGTGCCTGCTGAACACCCAAGGG - Intronic
969075805 4:4576709-4576731 AGTCCCTGCTGGGCATCCCTGGG - Intergenic
969342706 4:6552351-6552373 GGTTCCTGCTGGAGGCCCCAGGG + Intronic
973912119 4:55592045-55592067 GGGCCCAGCTGGAGACCCACTGG + Intronic
982722030 4:158869199-158869221 GGGCCCCGCTGGACACACCTGGG - Exonic
983474418 4:168196400-168196422 GGCACCTGCTGGCCACCCACTGG + Intergenic
985407063 4:189648375-189648397 AGACACTGCTGGAAACCCCCAGG - Intergenic
988836427 5:35037107-35037129 CGTCCCTCCTGCACACACCCTGG + Intronic
997179396 5:131812807-131812829 GGTCCCTGCAGGTGACTCCCAGG + Intronic
997277192 5:132604611-132604633 GTTCCCTGCTGGCCACTCACAGG - Intronic
997529373 5:134572566-134572588 GGTCCCAGCTGGAAAGACCCTGG + Intronic
1001544683 5:172563634-172563656 GGTCTCTCCTGGACAGCACCTGG - Intergenic
1002567128 5:180118565-180118587 GTTCCCTGCTGCAGCCCCCCTGG + Intronic
1003133642 6:3416688-3416710 GGTCCCTGCTGGCCAGGCCATGG + Intronic
1003181301 6:3794175-3794197 TGTCCCTGCTGGAACTCCCCTGG + Intergenic
1018720662 6:166569510-166569532 GGTCCCTGCTGGGGCCGCCCTGG + Intronic
1019176551 6:170162210-170162232 GGTCCCTCCTGGCATCCCCCAGG - Intergenic
1019476569 7:1247382-1247404 GGGACCTGCTGGAGACCCGCAGG + Intergenic
1019698195 7:2459714-2459736 GGTCCCTCCAGAAGACCCCCAGG + Intergenic
1020142977 7:5622533-5622555 GGTCCCTGCTGCTCACACCTGGG - Intronic
1022937731 7:35197417-35197439 GGTCCCAGCTGGCCACTCACAGG - Intergenic
1025070732 7:55896070-55896092 CCACCCTCCTGGACACCCCCAGG - Intronic
1025150614 7:56543601-56543623 GGTCCTTTCTGGACACCCCTGGG - Intergenic
1025237497 7:57244780-57244802 GGTCTCTGCTGGGCTCCCGCTGG - Intergenic
1025260409 7:57414343-57414365 GGTCCTTTCTGGACACCCCTGGG + Intergenic
1028372396 7:90108174-90108196 GGTCCCAGCTGGCCACTCACAGG + Intergenic
1029116663 7:98241173-98241195 GGTCCCTGCTGGACACCCCCGGG - Exonic
1029477512 7:100793820-100793842 GGTACCTGCTGGACACTCCATGG - Exonic
1030301493 7:107978972-107978994 GGTCCCTCCTGGACCCACCTTGG + Intronic
1030688606 7:112510511-112510533 GGTGTCTACTAGACACCCCCAGG - Intergenic
1033732032 7:144189482-144189504 CATCCCTGCTGAACAACCCCTGG + Intronic
1033742881 7:144288065-144288087 CATCCCTGCTGAACAACCCCTGG + Intergenic
1033751021 7:144361549-144361571 CATCCCTGCTGAACAACCCCTGG - Intronic
1034086884 7:148329849-148329871 TTTCCCTGATGCACACCCCCCGG + Intronic
1034165709 7:149023490-149023512 GGTCCCTGAGGGAGACCACCAGG + Intronic
1034357991 7:150468458-150468480 TGTGCCTGCTGTACACCCTCTGG - Intronic
1035247860 7:157576612-157576634 GGTCCCTCCTGGACTTCCGCAGG - Exonic
1035404009 7:158587053-158587075 GGTTCCAGCGCGACACCCCCAGG - Intronic
1036504162 8:9340089-9340111 TGTCCCTACTGGAAACTCCCAGG + Intergenic
1036766157 8:11550450-11550472 TGTCCCGGCTGGAAACCACCTGG + Intronic
1038486281 8:27937409-27937431 GGCCCCTGCTGCACAGCTCCTGG + Intronic
1039430454 8:37521445-37521467 GGGCCCTGCAGGGCCCCCCCAGG - Intergenic
1043891690 8:85656623-85656645 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043892762 8:85663460-85663482 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043895482 8:85735329-85735351 GCTCCCTGCTGGTTCCCCCCTGG + Intergenic
1043897197 8:85746479-85746501 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043899523 8:85764847-85764869 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043901131 8:85777040-85777062 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043903095 8:85792315-85792337 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043904704 8:85804508-85804530 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1043906317 8:85816699-85816721 GCTCCCTGCTGGTTCCCCCCTGG - Intergenic
1045815195 8:106270411-106270433 TATCCCTCCTGGACTCCCCCGGG - Intronic
1048344256 8:133565237-133565259 GCTCCCTGATGGAGCCCCCCAGG - Intronic
1048497266 8:134945790-134945812 GGGACCTGCTGGACATCCACTGG + Intergenic
1049179303 8:141212887-141212909 AGCCCCTGCTGGAGACCACCAGG - Intronic
1049261857 8:141643467-141643489 GGTCCCAGCTGGAAGCTCCCAGG - Intergenic
1049369569 8:142257430-142257452 GCTGCCTCCTGGAGACCCCCAGG + Intronic
1049804317 8:144532116-144532138 GGTGTCTGCTGGGCACCCCGAGG - Intronic
1049831843 8:144705716-144705738 GGTCCCTGCTCCCCATCCCCAGG + Intergenic
1053312107 9:37026726-37026748 CCTCCCTGCTGGAGACCGCCCGG + Intronic
1053409037 9:37903900-37903922 GGTCCCTGCGGGCCCCACCCAGG - Exonic
1053455902 9:38233035-38233057 TGTCCCTGCAGGACATACCCAGG + Intergenic
1057112774 9:92489851-92489873 GGTCCCCGCTGGACCCCCACTGG + Intronic
1057142913 9:92738349-92738371 GGTCCCTGATGGTCCCCCCAAGG + Intronic
1059416312 9:114164611-114164633 AGTCCCTGCTCAACAACCCCCGG - Intronic
1061177448 9:129006308-129006330 GGACCCGGCTGTGCACCCCCGGG + Exonic
1061881595 9:133571757-133571779 GATACCCTCTGGACACCCCCAGG - Intronic
1061908149 9:133709179-133709201 GGTTCGTGCTGGACACCACCGGG - Intronic
1062000531 9:134213682-134213704 GGCCCCTCCTGGACCTCCCCTGG - Intergenic
1062035743 9:134381795-134381817 CGCCCCTGCTGGGCACCCCGGGG - Intronic
1062123226 9:134845493-134845515 GGACCCTGCTGGAGACCCACTGG - Intergenic
1062231631 9:135485110-135485132 GGTCCTTGCTGGATCCCACCTGG - Exonic
1062415036 9:136444356-136444378 GGTCACTGCTGCACCCGCCCCGG + Intronic
1062461026 9:136662649-136662671 GGACCCTGCTGGAGACCCTGGGG - Intronic
1203658073 Un_KI270753v1:17480-17502 AGACACTGCTGGAAACCCCCAGG - Intergenic
1186216675 X:7308070-7308092 GGGGCCTGCTGGACTCCCCCAGG - Intronic
1186493471 X:9993107-9993129 TGTCCCGGCAGGAAACCCCCCGG - Intergenic
1190109777 X:47582485-47582507 GGTCCCTGCTGGGCCACCCCGGG - Intronic
1190532795 X:51396336-51396358 AGGCCCTGCTGGACACCTTCTGG + Intergenic
1191847122 X:65555240-65555262 GAGCCCTGCTGGACAGCCCCAGG - Intergenic
1195313887 X:103659057-103659079 GTTCACTGTTGGCCACCCCCTGG - Intergenic