ID: 1029118045

View in Genome Browser
Species Human (GRCh38)
Location 7:98248045-98248067
Sequence GTGCTTTGTAGGCATAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029118043_1029118045 -3 Left 1029118043 7:98248025-98248047 CCTTTCTCTCTTCTTTCTCTGTG 0: 1
1: 3
2: 95
3: 375
4: 2497
Right 1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG No data
1029118039_1029118045 11 Left 1029118039 7:98248011-98248033 CCACTGCACCCAGCCCTTTCTCT 0: 1
1: 16
2: 225
3: 1293
4: 6381
Right 1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG No data
1029118041_1029118045 2 Left 1029118041 7:98248020-98248042 CCAGCCCTTTCTCTCTTCTTTCT 0: 1
1: 0
2: 40
3: 546
4: 3590
Right 1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG No data
1029118042_1029118045 -2 Left 1029118042 7:98248024-98248046 CCCTTTCTCTCTTCTTTCTCTGT 0: 1
1: 5
2: 121
3: 611
4: 3806
Right 1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG No data
1029118040_1029118045 3 Left 1029118040 7:98248019-98248041 CCCAGCCCTTTCTCTCTTCTTTC 0: 1
1: 2
2: 14
3: 185
4: 1565
Right 1029118045 7:98248045-98248067 GTGCTTTGTAGGCATAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029118045 Original CRISPR GTGCTTTGTAGGCATAGCCA AGG Intronic
No off target data available for this crispr