ID: 1029118752

View in Genome Browser
Species Human (GRCh38)
Location 7:98252327-98252349
Sequence GTCGCGCGCCCGCCCACTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029118746_1029118752 27 Left 1029118746 7:98252277-98252299 CCTGGGACGTGCGATTGGCTGCG 0: 1
1: 0
2: 1
3: 0
4: 34
Right 1029118752 7:98252327-98252349 GTCGCGCGCCCGCCCACTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1029118750_1029118752 -1 Left 1029118750 7:98252305-98252327 CCGCGTCGGTGCTGGCTTCGAGG 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1029118752 7:98252327-98252349 GTCGCGCGCCCGCCCACTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029118752 Original CRISPR GTCGCGCGCCCGCCCACTTC CGG Intergenic
905819619 1:40979619-40979641 GTCCCGCGCCTGCGCACTCCAGG + Exonic
918602103 1:186375686-186375708 GTCGCCACCCCGCCCCCTTCTGG - Intronic
919658626 1:200221763-200221785 GTCGTGCTCCCTCCCACCTCTGG + Intergenic
1064397930 10:14996195-14996217 GGCGGGCGCCCGCCCACATAAGG - Intergenic
1072591563 10:96832543-96832565 GTCGCGCGCGCTCACACTCCGGG - Intronic
1074165741 10:110872275-110872297 GGCGCGGGCCCGCCCCCTCCCGG + Intronic
1080520707 11:33065760-33065782 GTGGCGCTCCCGCCCTCTGCTGG + Intronic
1087046846 11:93850154-93850176 GCGGCGCCCCGGCCCACTTCGGG - Intronic
1091985882 12:4910051-4910073 CTCGCCCGCCCGCCTCCTTCGGG + Exonic
1103544053 12:121687178-121687200 AACGCGATCCCGCCCACTTCCGG - Intergenic
1112088170 13:96053391-96053413 GCTGCGCGGCTGCCCACTTCCGG + Intronic
1114269310 14:21091488-21091510 GTGGCGCCCCGGCCCCCTTCAGG + Exonic
1114409790 14:22489931-22489953 ATCGCCTGCCCCCCCACTTCAGG - Intergenic
1116817625 14:49598734-49598756 GTTGCGCCCCCGCCGACTGCCGG + Exonic
1117899252 14:60515577-60515599 GGCGCGCGCCCGCCCACCCTCGG + Intergenic
1146281847 17:31549895-31549917 GTCCCGCGCCCGCCGCCTGCGGG - Intergenic
1157842096 18:50968134-50968156 GAAGCGCGCCCGCCCCCCTCTGG - Intronic
1160745764 19:710060-710082 GTCACCCACCTGCCCACTTCAGG + Intronic
1171346500 20:24469794-24469816 GCCGCGACCCCGCCCACTGCGGG - Intronic
1175756650 20:61534536-61534558 GTCCCGTGCCCTCCCACATCAGG - Intronic
1183538395 22:38416113-38416135 GTCCCGCTCACGCCCACTGCTGG - Intergenic
976897173 4:90127246-90127268 GACGCGCGCACACCCACTGCTGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1002186103 5:177455532-177455554 CTCCAACGCCCGCCCACTTCCGG - Intronic
1017842377 6:158232298-158232320 GCCCCGCGCCCGCTCACCTCCGG - Intronic
1024499854 7:50093263-50093285 GTCCTCCGCCCGCCAACTTCCGG - Exonic
1029118752 7:98252327-98252349 GTCGCGCGCCCGCCCACTTCCGG + Intergenic
1034951207 7:155298022-155298044 GGCCCGCGCCCGCCTACCTCCGG - Intronic
1035725710 8:1823942-1823964 ATCGCGCGCCCGCCGGCTACAGG - Intergenic
1050296522 9:4210807-4210829 GTCATGGGCCTGCCCACTTCTGG + Intronic
1056732492 9:89178175-89178197 GCCGCGCGCCCGCCCGCTCCCGG + Exonic