ID: 1029123214

View in Genome Browser
Species Human (GRCh38)
Location 7:98281767-98281789
Sequence GCCGGAGCGGCGGGCGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1078
Summary {0: 1, 1: 3, 2: 22, 3: 131, 4: 921}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029123196_1029123214 16 Left 1029123196 7:98281728-98281750 CCGCCGCGTCCCCCGCCGGGGCC 0: 1
1: 1
2: 5
3: 70
4: 700
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123201_1029123214 4 Left 1029123201 7:98281740-98281762 CCGCCGGGGCCGACCGAGCCGAG 0: 1
1: 1
2: 0
3: 5
4: 80
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123191_1029123214 22 Left 1029123191 7:98281722-98281744 CCGCCGCCGCCGCGTCCCCCGCC 0: 1
1: 15
2: 93
3: 1688
4: 4013
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123193_1029123214 19 Left 1029123193 7:98281725-98281747 CCGCCGCCGCGTCCCCCGCCGGG 0: 1
1: 0
2: 13
3: 134
4: 1011
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123207_1029123214 -9 Left 1029123207 7:98281753-98281775 CCGAGCCGAGCCGGGCCGGAGCG 0: 1
1: 1
2: 1
3: 21
4: 244
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123189_1029123214 26 Left 1029123189 7:98281718-98281740 CCCGCCGCCGCCGCCGCGTCCCC 0: 1
1: 7
2: 45
3: 549
4: 1636
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123188_1029123214 27 Left 1029123188 7:98281717-98281739 CCCCGCCGCCGCCGCCGCGTCCC 0: 1
1: 9
2: 60
3: 435
4: 1553
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123202_1029123214 1 Left 1029123202 7:98281743-98281765 CCGGGGCCGACCGAGCCGAGCCG 0: 1
1: 1
2: 3
3: 13
4: 93
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123200_1029123214 5 Left 1029123200 7:98281739-98281761 CCCGCCGGGGCCGACCGAGCCGA 0: 1
1: 1
2: 0
3: 4
4: 68
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123205_1029123214 -5 Left 1029123205 7:98281749-98281771 CCGACCGAGCCGAGCCGGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 97
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123190_1029123214 25 Left 1029123190 7:98281719-98281741 CCGCCGCCGCCGCCGCGTCCCCC 0: 1
1: 21
2: 185
3: 2136
4: 4647
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123199_1029123214 6 Left 1029123199 7:98281738-98281760 CCCCGCCGGGGCCGACCGAGCCG 0: 1
1: 1
2: 1
3: 16
4: 139
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123197_1029123214 13 Left 1029123197 7:98281731-98281753 CCGCGTCCCCCGCCGGGGCCGAC 0: 1
1: 0
2: 3
3: 15
4: 190
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921
1029123198_1029123214 7 Left 1029123198 7:98281737-98281759 CCCCCGCCGGGGCCGACCGAGCC 0: 1
1: 0
2: 2
3: 20
4: 207
Right 1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG 0: 1
1: 3
2: 22
3: 131
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029123214 Original CRISPR GCCGGAGCGGCGGGCGCGGC CGG Exonic