ID: 1029124200

View in Genome Browser
Species Human (GRCh38)
Location 7:98285864-98285886
Sequence CCTGAAGCCATGCTCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029124200_1029124210 25 Left 1029124200 7:98285864-98285886 CCTGCGCTGAGCATGGCTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1029124210 7:98285912-98285934 CGTCTCCCCTTTTCCTGGCGAGG No data
1029124200_1029124212 30 Left 1029124200 7:98285864-98285886 CCTGCGCTGAGCATGGCTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1029124212 7:98285917-98285939 CCCCTTTTCCTGGCGAGGCCTGG No data
1029124200_1029124208 20 Left 1029124200 7:98285864-98285886 CCTGCGCTGAGCATGGCTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1029124208 7:98285907-98285929 CCCTGCGTCTCCCCTTTTCCTGG No data
1029124200_1029124202 -6 Left 1029124200 7:98285864-98285886 CCTGCGCTGAGCATGGCTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1029124202 7:98285881-98285903 TTCAGGCCCTCAGCCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029124200 Original CRISPR CCTGAAGCCATGCTCAGCGC AGG (reversed) Intronic
900118388 1:1038290-1038312 CTTGAAGCCAGGCTGAGCACTGG - Intronic
900344999 1:2206272-2206294 CCTGCAGCCCTGCACAGCCCCGG + Intronic
900936420 1:5769021-5769043 CCTGAAGGCAGTCTCAGTGCTGG - Intergenic
901645943 1:10716796-10716818 ACTGACTCCATGCTCAGGGCCGG - Intronic
902377525 1:16036824-16036846 CCTGACACAAGGCTCAGCGCAGG + Intergenic
902382699 1:16060082-16060104 CCTGACACAAGGCTCAGCGCAGG + Intronic
903182346 1:21611359-21611381 CATCACGCCAGGCTCAGCGCTGG - Intronic
910291658 1:85605804-85605826 CCTGCAGCCCTGCCCAGGGCTGG - Intergenic
913244049 1:116856012-116856034 CATGATTCCAAGCTCAGCGCAGG + Intergenic
918090754 1:181292168-181292190 CCTGGAGCCATGATCAAGGCTGG + Intergenic
923550231 1:234957931-234957953 CCTGTGGCCAGGCTCAGCTCAGG + Intergenic
923831261 1:237560130-237560152 CCTGAATACATGCACAGCCCTGG + Intronic
924811738 1:247408796-247408818 CCTGAGTCCATGCTCAGTGGGGG + Intergenic
1062992768 10:1835553-1835575 CTTGAAGCCATGCACAGCCAGGG + Intergenic
1065930202 10:30472514-30472536 CCTGAAGCCATGGCCAGTTCTGG - Intergenic
1066997592 10:42578159-42578181 CCTCAAGCCAGGCTGAGCACAGG + Intronic
1069823097 10:71239583-71239605 CCAGAAGCTAACCTCAGCGCTGG - Intronic
1070752158 10:78970477-78970499 CCTCAGGCCATGCTCAGGGCAGG + Intergenic
1070771895 10:79087423-79087445 CCATAAGCCATGCTCTGGGCAGG - Intronic
1071438776 10:85670957-85670979 CCTGATGGCATTCTCAGAGCAGG - Intronic
1071668769 10:87587425-87587447 CCAGAAGCCATGCACATCCCTGG - Intergenic
1073479735 10:103778989-103779011 CCAGGAGCCAGGCTCAGAGCTGG - Intronic
1076186279 10:128452029-128452051 CCTGGAGCCATGCAGAGCCCAGG - Intergenic
1076536331 10:131180001-131180023 TCTCAGGCCATGCTCAGAGCAGG - Intronic
1076904519 10:133355454-133355476 CCTGCAGCCCAGCTCAGTGCTGG - Exonic
1076922564 10:133462176-133462198 CGTGGAGCCCTGCTCAGCTCTGG + Intergenic
1077484577 11:2832887-2832909 GCAGAAGCCATGCCCAGCTCAGG + Intronic
1080840793 11:35981782-35981804 GCTGTAGCCCTGCTCAGCACAGG + Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1084034420 11:66499953-66499975 CCTGAAGCCATGGACAGTACAGG - Intronic
1084458420 11:69282606-69282628 CAGGAAGCCAGGCTCAGTGCAGG - Intergenic
1084599044 11:70133972-70133994 CCGGCACCCATGCTCAGAGCTGG - Intronic
1089296458 11:117471829-117471851 CCTGAGGCCATGGGCAGGGCAGG + Intronic
1089527682 11:119107730-119107752 CCCGGATCCATGCTCCGCGCGGG - Exonic
1091154752 11:133362327-133362349 CCTGAAGGCTTGCTCCGCTCTGG + Intronic
1094056770 12:26276020-26276042 CCTGAAGCCTTGCACAGGGAAGG - Intronic
1094445400 12:30524231-30524253 CTTGAAGCCCTGCTCAGTGCTGG - Intergenic
1096630247 12:52921732-52921754 GCTGAACCCATGCCCAGCTCTGG - Intronic
1100326333 12:93543269-93543291 CCTGAAGCCATTCTTAGATCTGG + Intergenic
1102061156 12:109932250-109932272 CATGAAGCCATGTTCAGGGTAGG - Exonic
1104668555 12:130665203-130665225 CCTGATGCCATGCTCCGAGATGG + Intronic
1105006401 12:132723547-132723569 ACTGAGGCAATGCTCAGAGCAGG + Intergenic
1106575277 13:30968690-30968712 CCTGCAGCTCTGCTCAGCCCTGG + Intronic
1108362098 13:49677233-49677255 CCTGAAACAATGCTAAGAGCTGG + Intronic
1110679003 13:78285556-78285578 TCTGAAGCCCTCCTCAGCTCAGG + Intergenic
1112362675 13:98731202-98731224 ACAGAGGCCATGCTCAGCACAGG - Intronic
1112889589 13:104213088-104213110 CCTGAGTCCATGACCAGCGCCGG + Intergenic
1114671187 14:24411946-24411968 CCTGCAGCCATGCTGAGGGGTGG - Intronic
1115137895 14:30133048-30133070 CCTGATGCCATTCTCACCGGAGG + Intronic
1115341618 14:32298770-32298792 CCTGATCCCATGCCCAGGGCAGG + Intergenic
1118379308 14:65204751-65204773 CCTGCACCCCTGCTCAGCACTGG + Intergenic
1121272019 14:92644065-92644087 CCTGAAGAAATCCTCAGGGCTGG + Intronic
1124895411 15:33771926-33771948 CATGAAGTCAGGCTCAGAGCTGG + Exonic
1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG + Exonic
1126684858 15:51239891-51239913 CCAGATGCCATGCTCTGCCCGGG - Intronic
1128269176 15:66293724-66293746 CCTGCAGCCACGGTCAGGGCCGG + Exonic
1128450700 15:67804483-67804505 GCTGCAGCCATACTCAGCTCCGG - Intronic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1130403467 15:83578291-83578313 GCTGAAGCCAGGCTGAGGGCAGG - Intronic
1132135861 15:99337926-99337948 CCTGAAGCAATGCTCTGCCCTGG + Intronic
1132652837 16:1029257-1029279 CCAGCAGCCGTGCTCAGCGCCGG - Intergenic
1133339433 16:5027156-5027178 CCTGAAGCCACCCTGAGGGCGGG - Exonic
1136048052 16:27631141-27631163 CCTGGTGCCATCCTCGGCGCTGG - Exonic
1138720143 16:59070299-59070321 ACTGAAGCAATGCTCAGTCCAGG - Intergenic
1142743570 17:1943752-1943774 CCTGGAGCCTGGCTCAGCCCTGG + Intronic
1148158422 17:45436513-45436535 CCTGACTCCAAGCTGAGCGCAGG + Exonic
1151570758 17:74924295-74924317 CCTGACCCCCAGCTCAGCGCCGG + Exonic
1152236315 17:79140871-79140893 CCAGATGCCATGCTGAGGGCTGG + Intronic
1152451421 17:80383544-80383566 CCTGATTACATGCTCAGAGCAGG + Intronic
1156915630 18:42462542-42462564 CCTGAATCCATGACCAGTGCCGG - Intergenic
1158415599 18:57247389-57247411 CCTGCGGCCATGCTGGGCGCAGG - Intergenic
1162126559 19:8502554-8502576 CCTGCAGCCATGGTGAGTGCTGG - Exonic
1163831742 19:19550401-19550423 CATGAAGCCATGCCGAGCACAGG + Intergenic
1164436268 19:28232607-28232629 TCTGAAGCCATGCTCATGTCAGG + Intergenic
1164580845 19:29433956-29433978 CCCCAAGCCATGCTCAGTGCTGG + Intergenic
1165739349 19:38196215-38196237 CCTGATGCCCTGCTCAGCAATGG + Intronic
1165743204 19:38215880-38215902 CTTGATGCCATGCTAAGCACAGG + Intronic
926162199 2:10496831-10496853 TCTGAAGCCAAGGTCAGGGCAGG - Intergenic
927204383 2:20597946-20597968 CCTAGAGCCAGGCTCAGCCCTGG + Intronic
928137947 2:28702719-28702741 CCAGAAGCCAGGCTGAGTGCTGG + Intergenic
933770065 2:85737954-85737976 CCTGAAGCCAGCCTCATCTCTGG + Intergenic
934519144 2:95008433-95008455 CCTTAAGCCAAGCTGAGCGGGGG - Intergenic
934794039 2:97085621-97085643 CCTGAACCCATGCTCCTCCCTGG + Intronic
936656376 2:114492887-114492909 CCAGATGCCATGCTAAGCACTGG + Intronic
937321216 2:120961916-120961938 CCAGATGCCATCCTCAGCCCGGG - Intronic
937910030 2:127071040-127071062 CCAGATGCCATTCTCAGCCCAGG + Intronic
938595255 2:132782525-132782547 CCTGAAGCCCTGCAGAGCCCAGG - Exonic
944494351 2:200291252-200291274 CCTGAAGCCATTCTTAGGCCAGG - Intergenic
945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG + Exonic
1168820925 20:773467-773489 CCTGAGGCCTTTCTCAGGGCTGG - Intergenic
1172885717 20:38229585-38229607 CATGAAGCCAAGCCCAGAGCAGG + Intronic
1172940416 20:38650076-38650098 ACTGTAGCCATGATCAGCCCTGG + Exonic
1174088623 20:48028521-48028543 TCTGCAGCCATGCTCAGCTTGGG + Intergenic
1175295403 20:57905080-57905102 CCTGAAGCCTTGCTGAGCTATGG + Intergenic
1175691753 20:61070359-61070381 CCTGAAGCCTTTTTCAGCCCTGG + Intergenic
1175883162 20:62272036-62272058 CATGAAGGGATGCTCAGAGCAGG + Intronic
1176008230 20:62877588-62877610 CCTGAACTCATGCTGAGCCCAGG - Intergenic
1179269725 21:39841388-39841410 CCTCATGCCCTGCTCAGCCCAGG + Intergenic
1181083228 22:20427488-20427510 CCTGGAGCCACCCTCAGGGCTGG - Exonic
1181580490 22:23825311-23825333 CCTGAAGCTGTGCTCGGAGCTGG + Exonic
1182065492 22:27428631-27428653 CCTGGTGCCATGCTCTGTGCTGG - Intergenic
1183468064 22:37990076-37990098 CCTGAGGCCATGCTCAGCCTCGG + Intronic
1184123816 22:42472626-42472648 TCTGCTGCCATGCTCACCGCAGG - Intergenic
1184255075 22:43281889-43281911 CCTGAAGCCAGGCCCAAAGCTGG - Intronic
1184772509 22:46606021-46606043 CATGCAGACATGCTCAGCACTGG - Intronic
1184772518 22:46606086-46606108 CATGCAGACATGCTCAGCACCGG - Intronic
1184772537 22:46606247-46606269 CATGCAGACATGCTCAGCACTGG - Intronic
1184772546 22:46606312-46606334 CATGCAGACATGCTCAGCACCGG - Intronic
1184772565 22:46606473-46606495 CATGCAGACATGCTCAGCACTGG - Intronic
1184772574 22:46606538-46606560 CATGCAGACATGCTCAGCACCGG - Intronic
1184772584 22:46606603-46606625 CATGCAGACATGCTCAGCACCGG - Intronic
1184772592 22:46606668-46606690 CATGCAGACATGCTCAGCACCGG - Intronic
1185129358 22:49029070-49029092 CCTGCAGACATCCTCACCGCGGG + Intergenic
1185252052 22:49808059-49808081 CCTGAACCCTTGCGCACCGCCGG + Intronic
949944720 3:9180789-9180811 CCTGATGCCATGTTCAACTCAGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950999066 3:17537286-17537308 CCTGAGGCCATGCTAAGCAGTGG - Intronic
953182816 3:40612589-40612611 CCTAAACCCTTGCTCAGCACAGG + Intergenic
954121642 3:48503555-48503577 CCAGAGGCCAGCCTCAGCGCCGG + Intronic
958182061 3:90072554-90072576 CCTGAGTCCATGACCAGCGCCGG + Intergenic
961712967 3:128841280-128841302 CCTGAGTCCGTGATCAGCGCCGG + Intergenic
962400795 3:135057179-135057201 CCAGATGCCATGTTCAGCCCAGG + Intronic
964787689 3:160416725-160416747 CCTGGAGCCACACTAAGCGCAGG + Intronic
965659686 3:171028425-171028447 CCTGCCGCCGTGCTCCGCGCCGG - Intergenic
967362054 3:188642423-188642445 CCTGAAGCCACACACAGTGCCGG + Intronic
969571462 4:8011141-8011163 CCTGAAGCCAGGCTGACCTCTGG - Intronic
972111734 4:35570180-35570202 ACTGAAACCATGCTCACCACAGG + Intergenic
979231826 4:118355078-118355100 CCTGAGGCCATGCTCCTCTCTGG - Intergenic
983768763 4:171521047-171521069 TCTGAAGCAATGCTCAGTGTGGG - Intergenic
984104722 4:175531074-175531096 TCTGAAGACTTGCTCAACGCAGG + Intergenic
986142265 5:5041672-5041694 CCTGGAGCCTTGCTGAGCACCGG - Intergenic
986396976 5:7340887-7340909 CCCTAAGCCATGCTCTGTGCTGG - Intergenic
989986984 5:50712643-50712665 CCTGAAGGCATTCACAGAGCAGG + Intronic
991588171 5:68220712-68220734 CATGCTGCCATGCTCAGGGCTGG - Intronic
991973988 5:72168073-72168095 CCTGAGGCCCTCCTCAGCTCAGG - Intronic
996413249 5:123181798-123181820 CCTGAGGCCAGGCTCAGCTTGGG + Intronic
998695052 5:144629586-144629608 CATGGAGCCTTGCTCAGTGCTGG - Intergenic
999891842 5:155986484-155986506 CCTGATGCCATGCTCATCTCAGG - Intronic
1001611871 5:173009270-173009292 CCTGAAGCCATGCCCAGTGGTGG + Intronic
1001708654 5:173760489-173760511 CCTGAAGCCCTACTCAGTACTGG + Intergenic
1001963779 5:175896047-175896069 CCTGATGCCTTTCTCAGCCCAGG + Intergenic
1002176153 5:177402624-177402646 CCTGGAGCGCTGCTCAGCCCCGG - Exonic
1002918410 6:1547659-1547681 CCTGAAGCGGTGCTCTGCGTGGG - Intergenic
1002931317 6:1637056-1637078 CCTGGAGCCATGCCTGGCGCTGG - Intronic
1005434241 6:25791088-25791110 CCTGAAGCCAAGTTCAGCAATGG + Intronic
1006632144 6:35437168-35437190 CCTGGAACCATGCTAAGTGCTGG - Intergenic
1007397997 6:41588106-41588128 CCTGACTCCATCCCCAGCGCAGG + Intronic
1007686718 6:43671504-43671526 GCTTAGGCCATGCTCAGTGCTGG - Exonic
1007742444 6:44021151-44021173 CCTGAAACCATGATGAGCACGGG - Intergenic
1014261559 6:119224290-119224312 CCTGAATCCATGCTCTACTCAGG + Intronic
1017091066 6:150759527-150759549 CCTCAAGCCATGCTCAAACCAGG - Intronic
1017718221 6:157226895-157226917 CCTGGAGCTATGCTAAGGGCTGG - Intergenic
1018755819 6:166849109-166849131 CCTGAAGCCAAGCCCAGCTGAGG + Intronic
1019261966 7:86779-86801 CCCTAAGCCAGGCTCAGCACTGG - Intergenic
1026566009 7:71490339-71490361 CCTGAATCTATGTTCAGAGCCGG - Intronic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1031921862 7:127608331-127608353 GCTGAAGCCTTGCACAGAGCCGG - Intergenic
1032683904 7:134211075-134211097 CCTGAACCCATGGTCAGCGTAGG + Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1037577521 8:20221886-20221908 CCTGTAGGAATGCTCAGCCCTGG - Intronic
1040610339 8:48977148-48977170 CCGGAAGCCATGCACAGCTTTGG + Intergenic
1041324463 8:56650325-56650347 CCTGCAGCCTTGGTCAGCTCAGG + Intergenic
1042186494 8:66141115-66141137 CCTGAAGCAATGCTGAGCTTAGG + Intronic
1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG + Intergenic
1047752296 8:127890977-127890999 CCTCAAGCCCAGCTGAGCGCCGG - Intergenic
1048291545 8:133185234-133185256 CTGGAAGCCCTGCTCAGAGCTGG + Intergenic
1048865109 8:138755057-138755079 GATAATGCCATGCTCAGCGCCGG + Intronic
1048963217 8:139596964-139596986 CCTGAAGGCATCCTCTGAGCAGG - Intergenic
1050713511 9:8493082-8493104 CTTGCAGCCATGCTAAGCCCTGG + Intronic
1053133942 9:35637640-35637662 CCTGAGTCCATGACCAGCGCCGG - Intronic
1062653311 9:137589718-137589740 CCTGAAGCCCTGCTGAGAACTGG + Intronic
1185482876 X:460653-460675 CCTGAAGCGTGGCTCAGCCCTGG - Intergenic
1185617787 X:1433808-1433830 ACAGAAGCCAGGCACAGCGCAGG - Intronic
1186168441 X:6852137-6852159 CCTGTAGCCATGCACAGAGTAGG - Intergenic
1189332285 X:40151582-40151604 CCTGAGGCCAGGGTCAGCGGGGG + Intronic
1199872209 X:151909568-151909590 CCTGCAGCCATTCTCTGCGAGGG + Intergenic
1201540867 Y:15103331-15103353 CCTGAGTCCATGATCAGCGCTGG + Intergenic