ID: 1029124492

View in Genome Browser
Species Human (GRCh38)
Location 7:98287196-98287218
Sequence CGCTCTCCCCAGAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029124487_1029124492 4 Left 1029124487 7:98287169-98287191 CCGGGCGGCACTGCAGGGAAACA 0: 1
1: 0
2: 2
3: 17
4: 342
Right 1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG 0: 1
1: 0
2: 1
3: 21
4: 127
1029124483_1029124492 11 Left 1029124483 7:98287162-98287184 CCAGCTCCCGGGCGGCACTGCAG 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG 0: 1
1: 0
2: 1
3: 21
4: 127
1029124486_1029124492 5 Left 1029124486 7:98287168-98287190 CCCGGGCGGCACTGCAGGGAAAC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG 0: 1
1: 0
2: 1
3: 21
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029124492 Original CRISPR CGCTCTCCCCAGAGACCCGG GGG Intronic
901646575 1:10720045-10720067 TGCTCTGCCCAGAGGCCCTGTGG + Intronic
901831288 1:11894166-11894188 CACTCTCCCCAGACACTCTGGGG - Intergenic
902288923 1:15424260-15424282 CGCTGTTCCCAGAGACCAGTAGG + Intronic
902640186 1:17762105-17762127 GGCTCTCCCCAGCTACCAGGAGG - Intronic
904044162 1:27600286-27600308 CTCTGTCCCAAGAGACCCAGGGG + Intronic
913660650 1:121003628-121003650 CTCCCTCCCCAGTGACCCAGAGG - Intergenic
922479820 1:225931886-225931908 CGCTCTCCCCAAAGACACCTGGG - Intergenic
1064310515 10:14208345-14208367 AGCCCTCCCCAGAGACCTGGGGG - Intronic
1064609298 10:17080565-17080587 TCCTCTCCCCAGAGACACTGAGG - Intronic
1067285262 10:44903194-44903216 AGTCCTCCCCAGAGACCCAGGGG - Intergenic
1067709302 10:48635639-48635661 CACTCTTCCCAGAGTCCCTGTGG + Intronic
1067730655 10:48808852-48808874 CCCTGTCCCCAGGGACCCAGAGG + Intronic
1070264263 10:74887053-74887075 CCCTGTCCCCAGAGAGACGGTGG - Intronic
1072809220 10:98446529-98446551 CGCTCTCTCCAGAGACTCAGGGG - Intronic
1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083890203 11:65592191-65592213 CGTTCTCCCCAGCGCCCTGGAGG + Exonic
1086110566 11:83194058-83194080 CTCTCTCCCTAGAGACGCTGCGG - Intronic
1090350514 11:126104919-126104941 CGTTCTCCACAGAGACACGAGGG - Intergenic
1091159156 11:133404040-133404062 GGCTCCCCCTAGAGGCCCGGAGG + Intronic
1091342002 11:134823304-134823326 CCCTCTCCCCAGGGACAAGGGGG + Intergenic
1091442446 12:521922-521944 GGCTCTCCCCAGGGACAGGGAGG - Intronic
1095918475 12:47504693-47504715 CACTTTCCCCAGAGGCCAGGTGG - Intergenic
1096783081 12:54001842-54001864 TCCTCTCCCCAGAGAGCCGCTGG - Intronic
1097990622 12:65828016-65828038 CCCTCTCCTAAGAGACCCAGGGG + Exonic
1100391725 12:94150044-94150066 CGCTCTCCGCGGCGCCCCGGGGG - Intronic
1101716685 12:107318607-107318629 CGCTCTTCCCTGAGCCCCGCTGG - Exonic
1102237659 12:111304291-111304313 TGCTCTCCCCAGGGGCCCAGTGG + Exonic
1102478219 12:113202485-113202507 TGCTCTCCCCAGAGAGGCTGTGG + Intronic
1103730307 12:123022924-123022946 CTCCCTCCCCAGAGCCCCGCTGG + Intronic
1103792862 12:123483980-123484002 CTCTCTGCCCAGAGACCCCCAGG + Intronic
1104940315 12:132392050-132392072 CGCTCTCCCCAGGGACCCTCCGG + Intergenic
1104940340 12:132392107-132392129 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104940367 12:132392164-132392186 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104940393 12:132392221-132392243 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104940420 12:132392278-132392300 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104940447 12:132392335-132392357 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104940474 12:132392392-132392414 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104940501 12:132392449-132392471 CGCTCTCCCCCGGGACCCTCCGG + Intergenic
1104963264 12:132498084-132498106 CACCCTCCCCAGAGGCCCTGTGG - Intronic
1105024888 12:132841361-132841383 GACCCTCCCCAGAGCCCCGGGGG - Exonic
1105239187 13:18595380-18595402 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1121327190 14:93028036-93028058 GGCTCCCGCCAGAAACCCGGAGG + Intronic
1121635249 14:95449812-95449834 AGCTCTCCCCAGATATCCGGAGG + Intronic
1122858347 14:104570902-104570924 CCCTCTCCCCACAGGCCCGGAGG + Intronic
1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1124733162 15:32217212-32217234 ATCTCTCCCCAGAGACACAGTGG - Intergenic
1126822676 15:52520299-52520321 TGCTCACCCCAGAGACCAGGGGG - Intronic
1129389227 15:75212349-75212371 CCCTCTCTCCTGAGACCCCGTGG + Intergenic
1131635865 15:94232038-94232060 CTCTCTTCGTAGAGACCCGGAGG + Intronic
1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1132518713 16:377702-377724 CGCTCTCCCGGGAGACCTGCAGG + Exonic
1134884909 16:17781909-17781931 AGCTCTCCCCAGAGCTCAGGTGG + Intergenic
1135323476 16:21511977-21511999 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1136334964 16:29605242-29605264 CGCGCTCCCCAGAGGCCCTGTGG - Intergenic
1137530495 16:49276073-49276095 AGCTCTCCCCAGGGACCTGGAGG - Intergenic
1140479786 16:75256434-75256456 GCCAGTCCCCAGAGACCCGGGGG + Intronic
1141490336 16:84368390-84368412 CGCTGTCCCCAGAGCCCCTGGGG + Intergenic
1142035678 16:87861061-87861083 CACGCTCCCCAGAGGCCCTGTGG - Intronic
1142345228 16:89549763-89549785 CCCTCTCCCCTCAGACCTGGAGG - Intronic
1142738613 17:1917516-1917538 CGCTCTCCCCAGGTGCCTGGAGG - Intergenic
1143018544 17:3904469-3904491 CGCTCTCCCTAGGGCCCTGGGGG - Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148450823 17:47777043-47777065 CCCTCTCCCCAGTGTCCTGGGGG - Intergenic
1151188877 17:72383180-72383202 CGCCCTCCCCAGAGGTCAGGAGG - Intergenic
1151680144 17:75618884-75618906 CTCACTGCCCAGAGACCCCGTGG - Intergenic
1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1159241659 18:65750642-65750664 GGCGCCTCCCAGAGACCCGGTGG - Intronic
1160632014 18:80253472-80253494 CGATCCTCCCAGTGACCCGGGGG + Intergenic
1160729967 19:637186-637208 CGCTCCCTCCAGAGGCCCTGGGG + Intergenic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1163806885 19:19405233-19405255 CGCCCTCCCCACAGACACCGGGG + Intronic
1164593971 19:29521537-29521559 CGCTGTGCACAGAGACCTGGAGG - Intergenic
1165894295 19:39132144-39132166 GGCTGTACCCAGAGACCCTGAGG + Intronic
1165940769 19:39413698-39413720 CGCCCTCCCCTGGGACCCCGCGG + Intronic
1166354248 19:42217561-42217583 CCCGCTCCCCAGAGCCCAGGTGG + Intronic
1168101634 19:54144548-54144570 CGGTCTACCCAGACACCCAGGGG - Intronic
1168249306 19:55132823-55132845 CGCTCCCCTCAGACACCCGCTGG - Exonic
927685528 2:25168245-25168267 CGCTGTCTCCAGGGAGCCGGCGG - Intronic
929967985 2:46549774-46549796 CGTTCTACCCAGGGAGCCGGGGG - Intronic
935237708 2:101151925-101151947 TGCTCTCCCCAGGGATCCGACGG + Intronic
936014557 2:108947765-108947787 CTCTCCCACCACAGACCCGGAGG - Intronic
936370644 2:111899202-111899224 CGCTCTGGCCGGAGTCCCGGGGG + Intronic
938481834 2:131669487-131669509 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
947586238 2:231358609-231358631 CGCCCCACCCAGAGACCCCGTGG + Intronic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
948207154 2:236168320-236168342 CGCGCTCCCCAGCGGCCCGCGGG - Exonic
948429445 2:237909812-237909834 TGCTCTCCCCAGAGAGCCCTGGG + Intronic
948481787 2:238254895-238254917 GCGTCTGCCCAGAGACCCGGGGG + Intronic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1170548272 20:17453730-17453752 TGCTCTCCCCAGGGCCGCGGCGG + Exonic
1171233731 20:23508203-23508225 CCCTCTCCTCAGATACCCTGTGG + Intergenic
1171349540 20:24492149-24492171 GGCTCTCCCCAGCGTCCCTGCGG - Intronic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175892571 20:62322093-62322115 CGCTCCCCGCTGAGCCCCGGGGG + Exonic
1176040385 20:63062396-63062418 CTCTCTGCTCAGAGAGCCGGGGG + Intergenic
1178710119 21:34909687-34909709 CTCTGTAGCCAGAGACCCGGGGG - Intronic
1180004388 21:45013339-45013361 CTCTGTCCCCAGAGGGCCGGTGG - Intergenic
1181112665 22:20611099-20611121 CGCTCTCCCCAGTGACTCTGAGG + Intergenic
1181522823 22:23459319-23459341 CGCTCCCGCCAGCGACGCGGAGG + Intergenic
1182810041 22:33108377-33108399 AGCTCTCCCCAGTGACCCCAGGG + Intergenic
1183230383 22:36578445-36578467 AGGTCTCCCCAGAGCCCCAGTGG - Intronic
1185080777 22:48708324-48708346 TGCTCACACCAGAGACCCGGAGG + Intronic
953416644 3:42724289-42724311 TGCTCAGCCCAGATACCCGGGGG + Intronic
954128840 3:48549453-48549475 CGCTCACCCCAGCGCCCCGTGGG - Intronic
955360994 3:58274843-58274865 TACCCTCCCCAGAGGCCCGGGGG + Intronic
963603565 3:147396519-147396541 CGCTCTTCCCTGGGCCCCGGGGG + Intronic
966344832 3:178967532-178967554 CGCTCTTCCCCGAGACACTGAGG + Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
985493156 5:190909-190931 CCTTCTCCCCAAGGACCCGGCGG - Intergenic
989147052 5:38259010-38259032 CGCCCTCCCCCGAGCCCGGGCGG + Intronic
996404406 5:123091025-123091047 CGTGCTCCCCAGAGACGCTGAGG - Intronic
999878180 5:155831768-155831790 CGCTCTCCCTACAGACTCTGTGG - Intergenic
1001334164 5:170783893-170783915 CCCTCTCTCCAGACACCTGGAGG - Intronic
1005887994 6:30111802-30111824 AGCTCTCCTAAGAGACCAGGAGG - Intronic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1007251775 6:40500164-40500186 GGTTCTCCCCGGAGACCGGGAGG + Intronic
1007726840 6:43921778-43921800 GGTTCTCCCCATGGACCCGGGGG + Intergenic
1011494481 6:87925005-87925027 CCCTATCCCCAGAGAGCTGGCGG + Intergenic
1013412853 6:109897290-109897312 CCACCTCCCCAGAGACCAGGAGG - Intergenic
1016307924 6:142702822-142702844 CCTTCTCCTCAGAGCCCCGGAGG - Intergenic
1016732189 6:147438972-147438994 CGCTCTCCCCAGGCAGCCTGGGG + Intergenic
1017788037 6:157772562-157772584 TGCTCTCCCCAGAGGCTCTGGGG - Intronic
1017914278 6:158819381-158819403 CGCGCTCCCAAAAGCCCCGGCGG + Exonic
1018378917 6:163240183-163240205 CACTCACCCCACAGGCCCGGCGG - Intronic
1019417932 7:935702-935724 GGCTCTCCCCAGACACCCCACGG + Intronic
1019588501 7:1817218-1817240 CGCTCCCGCCAGCGACGCGGAGG - Intronic
1023843094 7:44107615-44107637 CGCTTTCCCCTCAGAGCCGGAGG + Exonic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1031966910 7:128033051-128033073 CGCTGCCCCCAGAGAACTGGGGG + Intronic
1034972512 7:155427954-155427976 CGCAGTCCCCAGAGACTGGGGGG - Intergenic
1035568598 8:658258-658280 CTCTCTCCCCAGTCACCTGGGGG - Intronic
1035909822 8:3554406-3554428 GGCTCTCCCCAGACCCCCAGAGG - Intronic
1036803867 8:11813909-11813931 CGTTTTCCCCAGAAACCCAGAGG - Intronic
1049102237 8:140588080-140588102 CGCTCTCTCCAGACACCCCATGG + Intronic
1052767992 9:32660827-32660849 CGCTCTCATCACAGGCCCGGAGG - Intergenic
1056054664 9:82808507-82808529 CTCTCTGCCCAGAGATCTGGAGG - Intergenic
1058417340 9:104802600-104802622 TGCTCTGCCCAGAGATCCAGGGG + Intronic
1059646165 9:116270091-116270113 CTCCCTCCCCAGAGACCAGCTGG - Intronic
1060822163 9:126667717-126667739 GTCTCTCCCCAGAGACCTGTGGG - Intronic
1061186668 9:129059063-129059085 CCCTTTCCCCAGGGACCTGGGGG + Intronic
1061222846 9:129262280-129262302 CCCTCTGCCCAGAGAGCGGGTGG - Intergenic
1062312145 9:135944639-135944661 GGCCCTGCCCAGAGACCGGGAGG - Intronic
1186837269 X:13450354-13450376 TCCTCTCCCCAGAGGCCAGGGGG + Intergenic
1187181533 X:16947213-16947235 GGCTGCCCCCAGGGACCCGGAGG + Intronic
1189235560 X:39484305-39484327 AGCCCTCCCCAGACTCCCGGAGG - Intergenic
1194691594 X:96992926-96992948 CTCTCTCCCAAAAGACCTGGTGG + Intronic
1200215462 X:154366264-154366286 GGCTCTCCCCACAGACCAGCTGG + Intronic