ID: 1029124492

View in Genome Browser
Species Human (GRCh38)
Location 7:98287196-98287218
Sequence CGCTCTCCCCAGAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029124483_1029124492 11 Left 1029124483 7:98287162-98287184 CCAGCTCCCGGGCGGCACTGCAG 0: 1
1: 0
2: 3
3: 19
4: 227
Right 1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG 0: 1
1: 0
2: 1
3: 21
4: 127
1029124486_1029124492 5 Left 1029124486 7:98287168-98287190 CCCGGGCGGCACTGCAGGGAAAC No data
Right 1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG 0: 1
1: 0
2: 1
3: 21
4: 127
1029124487_1029124492 4 Left 1029124487 7:98287169-98287191 CCGGGCGGCACTGCAGGGAAACA 0: 1
1: 0
2: 2
3: 17
4: 342
Right 1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG 0: 1
1: 0
2: 1
3: 21
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029124492 Original CRISPR CGCTCTCCCCAGAGACCCGG GGG Intronic