ID: 1029129221

View in Genome Browser
Species Human (GRCh38)
Location 7:98317584-98317606
Sequence CGGTGTGAACTGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029129221_1029129226 -7 Left 1029129221 7:98317584-98317606 CCCTCATCCCTCAGTTCACACCG 0: 1
1: 0
2: 1
3: 22
4: 166
Right 1029129226 7:98317600-98317622 CACACCGTCTGCATGCTGGCTGG No data
1029129221_1029129233 30 Left 1029129221 7:98317584-98317606 CCCTCATCCCTCAGTTCACACCG 0: 1
1: 0
2: 1
3: 22
4: 166
Right 1029129233 7:98317637-98317659 AGTTCACACCATCCACACACTGG 0: 2
1: 0
2: 3
3: 8
4: 138
1029129221_1029129227 -6 Left 1029129221 7:98317584-98317606 CCCTCATCCCTCAGTTCACACCG 0: 1
1: 0
2: 1
3: 22
4: 166
Right 1029129227 7:98317601-98317623 ACACCGTCTGCATGCTGGCTGGG 0: 1
1: 2
2: 5
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029129221 Original CRISPR CGGTGTGAACTGAGGGATGA GGG (reversed) Intronic
900337092 1:2169685-2169707 GGGTGCGCACAGAGGGATGACGG + Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901052078 1:6430270-6430292 GGGTGAGCACTGAGGGAGGAAGG + Intronic
901059025 1:6463139-6463161 GGGGGTGGCCTGAGGGATGAGGG + Exonic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905795911 1:40816515-40816537 CGTGGTGCACTGGGGGATGAGGG + Intronic
905827975 1:41041113-41041135 GGGTGTGAACTGAGTGACCAAGG + Intronic
906635898 1:47410342-47410364 CGGTGAGAAATGAGGAAGGAGGG + Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
908279207 1:62512793-62512815 AGGTGTGTATTGGGGGATGAAGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909433253 1:75614659-75614681 AGATGAGAACTGAGGGGTGAAGG - Intergenic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
917968141 1:180191380-180191402 CGGGGTGAGTTGAGGGGTGATGG + Intronic
918447971 1:184633513-184633535 CGGCGTGTTCTGAGGGATGGGGG - Intergenic
918692644 1:187500993-187501015 AGGTTTGAACTGAGGCCTGAAGG + Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922248247 1:223821511-223821533 AGGTGTGGACTGGGGGTTGAGGG + Intronic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1065636460 10:27741176-27741198 TGCACTGAACTGAGGGATGAGGG + Intronic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067517836 10:46968832-46968854 CAGTGGGAACTGAGAGATGGGGG - Intronic
1067644412 10:48082997-48083019 CAGTGGGAACTGAGAGATGGGGG + Intergenic
1069273847 10:66565388-66565410 ATGTGGGAACTGAGAGATGAGGG + Intronic
1070777005 10:79115647-79115669 TGGGGGGAACTGAGGGCTGAGGG + Intronic
1072709602 10:97707435-97707457 CGGTGTTCCCTGAGGGGTGAGGG + Intergenic
1073071895 10:100799556-100799578 GGATGTGAACTCAGGGATGTCGG - Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1076462025 10:130654338-130654360 AGGTGTGAGCTGAGGGCTGGGGG + Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1080589589 11:33710116-33710138 TGGTGTTGACTTAGGGATGAAGG + Exonic
1080599276 11:33806871-33806893 AGGTGAGAGCTGAGGGATGCTGG + Intergenic
1081039237 11:38190379-38190401 CTGTGTGAACTTAGGACTGAGGG + Intergenic
1083943539 11:65911575-65911597 CGGTGTAAACTGAGTCATGGGGG + Intergenic
1084555922 11:69875794-69875816 CGGGGTGAATGGAGGGGTGAGGG - Intergenic
1084594134 11:70107127-70107149 CGATTAGATCTGAGGGATGATGG + Intronic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1085389455 11:76175134-76175156 CGGTGTGATCTGAGGGCTCTAGG - Intergenic
1087648393 11:100834746-100834768 AGGTATGAACAGAGGGATGGAGG + Intronic
1087890067 11:103527823-103527845 CGGTGTGAAATGAAAAATGAGGG + Intergenic
1088551035 11:111012482-111012504 CGGAGTGAACGGAGGACTGAAGG + Intergenic
1090805985 11:130202520-130202542 GTGTCTGAACTGAGGGTTGAAGG + Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091589555 12:1835126-1835148 GGGAGGGATCTGAGGGATGAAGG + Exonic
1092232209 12:6782522-6782544 GGGTGTGAACTGAGGGAGACAGG + Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1103167523 12:118783107-118783129 CCGTGTTGTCTGAGGGATGAGGG + Intergenic
1104108733 12:125686987-125687009 AGGTGTACACTGAGGGATGATGG - Intergenic
1104108746 12:125687049-125687071 AGGTATGTACTGAGGGATGGTGG - Intergenic
1104896870 12:132168977-132168999 CGGAGTGCACTGAGGGATCTGGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1113943732 13:114032582-114032604 CGGTGTCAAGTGAGGGCTGAAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117225778 14:53657220-53657242 CGGTGTGAAGTGATGACTGAGGG - Intergenic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118006419 14:61568098-61568120 CGGTGGGCACAGAGAGATGAGGG - Intronic
1120204434 14:81572798-81572820 CGGTGTGTACTGAGAGCTGGAGG + Intergenic
1121089820 14:91173514-91173536 CGATGTGAACAGGGGGATCATGG - Intronic
1122836870 14:104434840-104434862 TGGGGTGGACTGAGGGAAGATGG + Intergenic
1123557954 15:21452096-21452118 CGGTAGGAACTGCGGGATGGGGG + Intergenic
1124719426 15:32098593-32098615 TGGTGGGAACCGAGGGATAAAGG + Intronic
1126138349 15:45414188-45414210 CGCTGAGACCTGAGTGATGAGGG + Intronic
1127679259 15:61276783-61276805 GGAAGTGAACTGAGGGAGGAGGG - Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1132397271 15:101483048-101483070 GGGTGTGAACTGAGGGACAGAGG - Intronic
1133345149 16:5064894-5064916 GGGTGTAACCTCAGGGATGACGG + Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133978768 16:10618699-10618721 GGCTGTGAACTGGGGGAAGAAGG + Intergenic
1134111457 16:11517793-11517815 GGGTGGGAAGTGAGGGGTGATGG + Intronic
1136419762 16:30124282-30124304 CGGGGTGAGCTGAGGCATAAAGG + Intergenic
1137625366 16:49904362-49904384 GTGTGTGGACTGAGAGATGAGGG - Intergenic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1151037054 17:70812753-70812775 CAGTGTGTACTAAGGGATGGGGG - Intergenic
1151833202 17:76567977-76567999 CGATGTGAACTCAGGCCTGAGGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156460536 18:37319131-37319153 CCGTGTGAACTGGGGGCTGCAGG + Intronic
1161607249 19:5222018-5222040 TGGTGTGAAGTGAGGGATCAGGG - Intronic
1165157732 19:33798039-33798061 CGGTGTGAACTTAGGGGCGACGG - Intronic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166597070 19:44059417-44059439 TGGTGTGCACTGTGGCATGAAGG + Intronic
1166606520 19:44148213-44148235 TTGTGTGCACTGAGGCATGATGG + Intronic
925270018 2:2598798-2598820 TGGTGTGGACTGATGGGTGAAGG - Intergenic
926707102 2:15844641-15844663 CATTCTGATCTGAGGGATGAGGG - Intergenic
927093832 2:19732723-19732745 CGAGGTGAACTGAATGATGATGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
931220199 2:60282582-60282604 AGGTGTGAACTGTGAGAGGATGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
940535876 2:154943671-154943693 GAGTTTGAAATGAGGGATGAGGG - Intergenic
943387596 2:187221750-187221772 TGGTGTGGAATGAGGGTTGAGGG + Intergenic
944275927 2:197837577-197837599 GGATGGGAACTGAAGGATGAAGG + Intronic
945779779 2:214155017-214155039 AGGTTTCAACTCAGGGATGAAGG + Intronic
947794612 2:232886331-232886353 CAGTGTGTACTGTGTGATGAGGG + Intronic
1168832562 20:854607-854629 CGGTGGACACTGAGGGAGGAGGG - Intronic
1170008060 20:11690436-11690458 CTGTGTGAATTGATGAATGAAGG - Intergenic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171950342 20:31415819-31415841 CAGTGTGAACTGAGGAGTGGTGG + Intergenic
1173067465 20:39727045-39727067 AGGTGTGAACTGGGAGATCAGGG - Intergenic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184505035 22:44895373-44895395 CTGTGTGACCTTACGGATGAGGG - Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185101544 22:48843413-48843435 CGGTGTGAGGTGTGGGATGTGGG + Intronic
952722231 3:36545371-36545393 AGGTGGGAAGTGAGGGATGCAGG - Intronic
954078759 3:48200247-48200269 CGGTGTGAGCCAAGGTATGATGG - Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955862978 3:63352141-63352163 TGGTGTGCACTGAGGGGAGAGGG + Intronic
960974368 3:123160564-123160586 TGATGTGATGTGAGGGATGAGGG - Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
971414637 4:26413058-26413080 CGGATTTAACTGAGGGAGGAGGG - Intronic
975170838 4:71230482-71230504 CTGTGTGAAGTGAGAGATTATGG + Intronic
975742597 4:77443852-77443874 CATAGTGAACTGAGGGATGTTGG - Intergenic
976081423 4:81359308-81359330 AGGTGGGAACTGAGAGATGTTGG + Intergenic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
978323889 4:107528786-107528808 CCGTGTGAACTGTGGAATAAAGG - Intergenic
979043391 4:115830509-115830531 TGTTGTGAGCTGAGGGGTGAGGG - Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
987451956 5:18096263-18096285 AGGTGTGAACTTAGTGAGGATGG - Intergenic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
991638752 5:68732876-68732898 GGGAGTGGACTGAGGGCTGATGG - Intergenic
993687821 5:90961563-90961585 CGTAGTAAACTGAGGGAGGAGGG + Intronic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1001514868 5:172348417-172348439 CGTTCTGGACCGAGGGATGAGGG + Intronic
1003456463 6:6287310-6287332 TGGTCTGAACTCAGGGAGGACGG - Intronic
1005887164 6:30106004-30106026 AGGGGTGAACTGGGAGATGAAGG - Intronic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1008048335 6:46874299-46874321 AGGTGTGAACAGAGGCATGGAGG - Intronic
1011713051 6:90074407-90074429 CGCTGGGAACTCAGGGACGATGG + Intronic
1012220992 6:96649217-96649239 CGGTGGTAACTTAGAGATGAAGG - Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016989526 6:149919767-149919789 AGGTCTGAACTTAGGGATGACGG + Exonic
1016993525 6:149945336-149945358 AGGTCTGAACTTAGGGATGACGG - Exonic
1017004808 6:150022194-150022216 AGGTCTGAACTTAGGGATGACGG + Exonic
1017006733 6:150032796-150032818 AGATCTGAACTTAGGGATGATGG - Intergenic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018619327 6:165714987-165715009 CGGTGTGAACTGAGAGCTCTGGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024056070 7:45660518-45660540 CTCTGTGAACTGAGGGGTGCTGG + Intronic
1026179185 7:68023708-68023730 CGATGCAAACTCAGGGATGAAGG - Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029129229 7:98317625-98317647 TGGTGTGAACTGCAGGGTGAGGG - Intronic
1029129245 7:98317704-98317726 TGGTGTGAACTGCGGGGTGATGG - Intronic
1029129280 7:98317907-98317929 TGATGTGAACTGTGGGGTGAGGG - Intronic
1029129298 7:98317986-98318008 TGGTGTGAGCTGCGGGGTGAGGG - Intronic
1029129313 7:98318068-98318090 TGGTGTGAACTGCGGGTTGAGGG - Intronic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1031997957 7:128245268-128245290 GTGTGTGAACTGAGGCCTGAAGG - Intronic
1033408351 7:141092452-141092474 CCATATGAACTGAGGGAGGATGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035587621 8:787850-787872 TGCTGTGAGGTGAGGGATGAGGG + Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1039436808 8:37565055-37565077 CGGTGGGAAATGAGGGTGGATGG - Intergenic
1044847068 8:96392468-96392490 AGGTGGGAACAGAGGGGTGAAGG - Intergenic
1050077216 9:1877698-1877720 AGGTGGGAACTGAGGGACCAAGG + Intergenic
1052343164 9:27382693-27382715 TGGTGTGAAATGAGAGGTGAAGG + Intronic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1060413284 9:123413830-123413852 TGGTGTGAATTGAGGGGTGGGGG - Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1185994710 X:4932695-4932717 TGTAGTGAGCTGAGGGATGATGG + Intergenic
1187388755 X:18872166-18872188 ACGTGTGCACTGAGTGATGAGGG + Intergenic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1198801010 X:140447762-140447784 GGGTGTGAGGTGGGGGATGAGGG - Intergenic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic