ID: 1029133339

View in Genome Browser
Species Human (GRCh38)
Location 7:98350326-98350348
Sequence CATGGTTACAAGATATCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029133332_1029133339 20 Left 1029133332 7:98350283-98350305 CCTTGGCAGCGAGAAAGATGAGC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1029133339 7:98350326-98350348 CATGGTTACAAGATATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029133339 Original CRISPR CATGGTTACAAGATATCCAA AGG Intronic
No off target data available for this crispr