ID: 1029147775

View in Genome Browser
Species Human (GRCh38)
Location 7:98458852-98458874
Sequence GAGGCCTGGCCTGATTCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029147775_1029147779 -10 Left 1029147775 7:98458852-98458874 CCTCGGGAATCAGGCCAGGCCTC No data
Right 1029147779 7:98458865-98458887 GCCAGGCCTCGGCCCACCTGGGG No data
1029147775_1029147785 25 Left 1029147775 7:98458852-98458874 CCTCGGGAATCAGGCCAGGCCTC No data
Right 1029147785 7:98458900-98458922 TTATTTTATTTTCTCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029147775 Original CRISPR GAGGCCTGGCCTGATTCCCG AGG (reversed) Intergenic
No off target data available for this crispr