ID: 1029147965

View in Genome Browser
Species Human (GRCh38)
Location 7:98459812-98459834
Sequence AGAGAGCAGGAGAAATTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029147959_1029147965 3 Left 1029147959 7:98459786-98459808 CCACCAGAGGCTTTACCCAGAGG No data
Right 1029147965 7:98459812-98459834 AGAGAGCAGGAGAAATTCCCTGG No data
1029147958_1029147965 6 Left 1029147958 7:98459783-98459805 CCACCACCAGAGGCTTTACCCAG No data
Right 1029147965 7:98459812-98459834 AGAGAGCAGGAGAAATTCCCTGG No data
1029147961_1029147965 0 Left 1029147961 7:98459789-98459811 CCAGAGGCTTTACCCAGAGGAAG No data
Right 1029147965 7:98459812-98459834 AGAGAGCAGGAGAAATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029147965 Original CRISPR AGAGAGCAGGAGAAATTCCC TGG Intergenic
No off target data available for this crispr