ID: 1029149918

View in Genome Browser
Species Human (GRCh38)
Location 7:98472551-98472573
Sequence AGGAGCAGCTGCGGGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029149908_1029149918 3 Left 1029149908 7:98472525-98472547 CCAAGCCCAGCACGTTGGCTGCA No data
Right 1029149918 7:98472551-98472573 AGGAGCAGCTGCGGGGGCTCTGG No data
1029149909_1029149918 -2 Left 1029149909 7:98472530-98472552 CCCAGCACGTTGGCTGCACCCAG No data
Right 1029149918 7:98472551-98472573 AGGAGCAGCTGCGGGGGCTCTGG No data
1029149910_1029149918 -3 Left 1029149910 7:98472531-98472553 CCAGCACGTTGGCTGCACCCAGG No data
Right 1029149918 7:98472551-98472573 AGGAGCAGCTGCGGGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029149918 Original CRISPR AGGAGCAGCTGCGGGGGCTC TGG Intergenic
No off target data available for this crispr