ID: 1029155496

View in Genome Browser
Species Human (GRCh38)
Location 7:98514569-98514591
Sequence GAAATATCGTAATTGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155496_1029155507 13 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155507 7:98514605-98514627 AAATATCCTGGGTGACACTGGGG No data
1029155496_1029155502 2 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155502 7:98514594-98514616 GGGTGTCCCAGAAATATCCTGGG No data
1029155496_1029155508 14 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155508 7:98514606-98514628 AATATCCTGGGTGACACTGGGGG No data
1029155496_1029155509 15 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155509 7:98514607-98514629 ATATCCTGGGTGACACTGGGGGG No data
1029155496_1029155501 1 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG No data
1029155496_1029155506 12 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155506 7:98514604-98514626 GAAATATCCTGGGTGACACTGGG No data
1029155496_1029155512 30 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155496_1029155511 23 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155511 7:98514615-98514637 GGTGACACTGGGGGGTGCTGAGG No data
1029155496_1029155505 11 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155505 7:98514603-98514625 AGAAATATCCTGGGTGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155496 Original CRISPR GAAATATCGTAATTGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr