ID: 1029155499

View in Genome Browser
Species Human (GRCh38)
Location 7:98514575-98514597
Sequence ACCCAAGAAATATCGTAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155499_1029155509 9 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155509 7:98514607-98514629 ATATCCTGGGTGACACTGGGGGG No data
1029155499_1029155501 -5 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG No data
1029155499_1029155511 17 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155511 7:98514615-98514637 GGTGACACTGGGGGGTGCTGAGG No data
1029155499_1029155507 7 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155507 7:98514605-98514627 AAATATCCTGGGTGACACTGGGG No data
1029155499_1029155502 -4 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155502 7:98514594-98514616 GGGTGTCCCAGAAATATCCTGGG No data
1029155499_1029155512 24 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155499_1029155506 6 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155506 7:98514604-98514626 GAAATATCCTGGGTGACACTGGG No data
1029155499_1029155508 8 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155508 7:98514606-98514628 AATATCCTGGGTGACACTGGGGG No data
1029155499_1029155505 5 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155505 7:98514603-98514625 AGAAATATCCTGGGTGACACTGG No data
1029155499_1029155513 25 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155513 7:98514623-98514645 TGGGGGGTGCTGAGGTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155499 Original CRISPR ACCCAAGAAATATCGTAATT GGG (reversed) Intergenic
No off target data available for this crispr