ID: 1029155501

View in Genome Browser
Species Human (GRCh38)
Location 7:98514593-98514615
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155495_1029155501 2 Left 1029155495 7:98514568-98514590 CCCTGAGCCCAATTACGATATTT No data
Right 1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG No data
1029155500_1029155501 -6 Left 1029155500 7:98514576-98514598 CCAATTACGATATTTCTTGGGTG No data
Right 1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG No data
1029155496_1029155501 1 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG No data
1029155499_1029155501 -5 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155501 Original CRISPR TGGGTGTCCCAGAAATATCC TGG Intergenic