ID: 1029155503

View in Genome Browser
Species Human (GRCh38)
Location 7:98514600-98514622
Sequence GTGTCACCCAGGATATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155503_1029155512 -1 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155503_1029155511 -8 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155511 7:98514615-98514637 GGTGACACTGGGGGGTGCTGAGG No data
1029155503_1029155513 0 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155513 7:98514623-98514645 TGGGGGGTGCTGAGGTCTTAGGG No data
1029155503_1029155515 19 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155515 7:98514642-98514664 AGGGCCAGCTGTGGTTTCAGAGG No data
1029155503_1029155514 10 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155514 7:98514633-98514655 TGAGGTCTTAGGGCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155503 Original CRISPR GTGTCACCCAGGATATTTCT GGG (reversed) Intergenic
No off target data available for this crispr