ID: 1029155505

View in Genome Browser
Species Human (GRCh38)
Location 7:98514603-98514625
Sequence AGAAATATCCTGGGTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155496_1029155505 11 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155505 7:98514603-98514625 AGAAATATCCTGGGTGACACTGG No data
1029155499_1029155505 5 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155505 7:98514603-98514625 AGAAATATCCTGGGTGACACTGG No data
1029155495_1029155505 12 Left 1029155495 7:98514568-98514590 CCCTGAGCCCAATTACGATATTT No data
Right 1029155505 7:98514603-98514625 AGAAATATCCTGGGTGACACTGG No data
1029155500_1029155505 4 Left 1029155500 7:98514576-98514598 CCAATTACGATATTTCTTGGGTG No data
Right 1029155505 7:98514603-98514625 AGAAATATCCTGGGTGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155505 Original CRISPR AGAAATATCCTGGGTGACAC TGG Intergenic