ID: 1029155512

View in Genome Browser
Species Human (GRCh38)
Location 7:98514622-98514644
Sequence CTGGGGGGTGCTGAGGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155503_1029155512 -1 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155496_1029155512 30 Left 1029155496 7:98514569-98514591 CCTGAGCCCAATTACGATATTTC No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155499_1029155512 24 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155504_1029155512 -2 Left 1029155504 7:98514601-98514623 CCAGAAATATCCTGGGTGACACT No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data
1029155500_1029155512 23 Left 1029155500 7:98514576-98514598 CCAATTACGATATTTCTTGGGTG No data
Right 1029155512 7:98514622-98514644 CTGGGGGGTGCTGAGGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155512 Original CRISPR CTGGGGGGTGCTGAGGTCTT AGG Intergenic
No off target data available for this crispr