ID: 1029155513

View in Genome Browser
Species Human (GRCh38)
Location 7:98514623-98514645
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029155503_1029155513 0 Left 1029155503 7:98514600-98514622 CCCAGAAATATCCTGGGTGACAC No data
Right 1029155513 7:98514623-98514645 TGGGGGGTGCTGAGGTCTTAGGG No data
1029155499_1029155513 25 Left 1029155499 7:98514575-98514597 CCCAATTACGATATTTCTTGGGT No data
Right 1029155513 7:98514623-98514645 TGGGGGGTGCTGAGGTCTTAGGG No data
1029155504_1029155513 -1 Left 1029155504 7:98514601-98514623 CCAGAAATATCCTGGGTGACACT No data
Right 1029155513 7:98514623-98514645 TGGGGGGTGCTGAGGTCTTAGGG No data
1029155500_1029155513 24 Left 1029155500 7:98514576-98514598 CCAATTACGATATTTCTTGGGTG No data
Right 1029155513 7:98514623-98514645 TGGGGGGTGCTGAGGTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029155513 Original CRISPR TGGGGGGTGCTGAGGTCTTA GGG Intergenic